Genomic researchers and virologists from the EVT Viral Genomics and Sequencing Lab at Louisiana State University (LSU) Health Shreveport are the first in America to sequence and report that a new variant of SARS-CoV-2, the coronavirus that causes COVID-19, has been detected in the state of Louisiana.

According to the study team, the new B.1.630 variant, was sequenced last week from two samples collected in Baton Rouge.

Alarmingly the new variant spots the E484Q mutation and also other mutations and deletions that are being studied and is thought to be immune evasive.
Though it has a low dominance, it seems to be very gradually growing with more than 79 similar sequences now detected across the United States.

Dr Chris Kevil, Vice Chancellor for Research at LSU Health Shreveport told Thailand Medical News, “Thanks to our many partnerships across the state, our EVT Viral Genomics and Sequencing Lab is able to sequence a large variety of samples which increases our chances of finding new variants. Genomic sequencing and the data this science provides is important to continuing our mission of public health surveillance so we can help best protect citizens of Louisiana throughout the duration of this pandemic.”

Records from GISAID and Nextstrain platforms indicated that the B.1.630 variant most probably emerged around March 2021 in America.

The B.1.630 does not have variant classification or a Greek alphabet name like the commonly known Delta variant because it accounts for such a small proportion of samples sequenced.

It does contain the E484Q mutation, which may help the virus escape the host immune system and lead to infection. Currently its predominance is very low but stringent genomic surveillance is warranted.

Dr Krista Queen, Director of Viral Genomics and Surveillance for the Center of Excellence for Emerging Viral Threats at Louisiana State University added, “Even though the predominance of this variant is low, we will continue to keep an eye on it and watch for any changes or if it starts to increase.

Any lineage or sub-lineage of SARS-CoV-2 with this E484Q mutation is watched because of the possibility of immune evasion. Some of the variants that do not have other mutations that increase transmissibility will eventually die out, but it is important to monitor any changes in abundance.”

She also stressed, “Although viruses that contain this mutation may be able to escape the immune response and resist antibodies, vaccination still remains our best tool to prevent at least disease severity or mortality risk.”

“Mutations in viruses are not uncommon. RNA viruses, like the virus that cause COVID-19, are more prone to mutation because of their method of copying their genome. Vaccination does not prevent the virus from mutating; however, the virus does not get the opportunity to mutate in the case of infections prevented by vaccination. The higher the percentage of the population that is vaccinated, the fewer chances the virus gets to mutate into new lineages that could be potentially more transmissible or more harmful lineages.”

So far, the EVT Viral Genomics and Sequencing Lab has completed genome sequencing for more than 7,000 COVID-19 test samples and is the top submitter in the state of Louisiana to the global GISAID database. LSUHS scientists are still seeing the B.1.617.2 (Delta) SARS-CoV-2 variant as the most prevalent in North Louisiana.


The emergence of SARS-CoV-2 variants that reduce antibody neutralization and vaccine efficacy is of significant global concern. On 24 March 2021, the Indian SARS-CoV-2 Consortium on Genomics reported that a variant containing a unique combination of two spike receptor-binding domain (RBD) neutralization resistance mutations, L452R and E484Q, made up 15 to 20% of positive cases in the Maharashtra state, which includes Mumbai (https://pib.gov.in/PressReleaseIframePage.aspx?PRID=1707177).

Here, we report the rapid recognition of this variant in the San Francisco Bay Area, CA, through investigation of unusual reverse transcriptase real-time PCR (RT-qPCR) curves and confirmation by viral whole-genome sequencing (WGS).

The Stanford Health Care Clinical Virology Laboratory prospectively screened SARS-CoV-2-positive respiratory specimens for three mutations, L452R (HEX), E484K (Cy5), and N501Y (FAM) using a laboratory-developed, multiplex, mutation-specific RT-qPCR (1). This approach allowed high-throughput screening for known variants of concern at the time (B.1.1.7, P.1, B.1.351, and B.1.427/B.1.429) and enabled informed deployment of sequencing resources.

In early March, we observed SARS-CoV-2 samples strongly positive for L452R with unusually shaped, reproducible amplification curves in the E484K Cy5 channel (Fig. 1A). Samples with this pattern of reactivity were identified from five COVID-19 patients.

Four of these individuals shared two unrelated household transmission events, one of which involved an individual in their 70s with known exposures in India who presented with moderate symptoms 3 days after their return flight to the United States. The other individuals had mild COVID-19 symptoms; one was infected more than 2 weeks after receiving a second dose of the Pfizer vaccine.

FIG 1 (A) Unusual real-time, reverse transcription-PCR fluorescence amplification curve in a sample with the E484Q mutation relative to wild-type (E484E) or E484K sequence. The Cy5-labeled E484K probe (CTTGTAATGGTGTTAAAGGTTT) has a single mismatch (indicated with boldface and underlining) with the E484Q template (CTTGTAATGGTGTTCAAGGTTT) resulting in a blunted fluorescence amplification curve. RT-qPCR was performed on the Bio-Rad CFX96 with an annealing temperature of 57°C. (B) Whole-genome phylogenetic tree reveals clustering with other B lineage SARS-CoV-2 containing spike L452R and E484Q mutations. This subtree (150 genomes) was generated using the University of California Santa Cruz (UCSC) Ultrafast Sample placement on Existing tRees (UShER) tool. (C) Whole-genome phylogenetic tree highlighting sequences with the L452R mutation. This tree (1,065 genomes) demonstrates that the L452R/E484Q-containing viruses arose separately from the B.1.427/B.1.429 variants.

SARS-CoV-2 WGS was initially performed on a specimen from one of the mildly symptomatic, unvaccinated individuals. Briefly, viral genome enrichment was conducted using laboratory-developed multiplex RT-PCRs that generate multiple overlapping amplicons ∼1,200 base pairs in length. Fragment libraries were prepared using NEBNext DNA library prep reagents for Illumina (New England BioLabs, Ipswich, MA) and were sequenced on an Illumina MiSeq using single-end 150-cycle sequencing using MiSeq reagent kit v3. Genomes were assembled via a custom assembly and bioinformatics pipeline using NCBI GenBank accession no. NC_045512.2 as reference.

We observed 386× mean whole-genome coverage for this sample; 50× coverage was obtained over 92.8% of the genome and 99.95% of spike. The sequence revealed a G/20A clade, B lineage virus containing eight nonsynonymous mutations in the spike protein, G142D, E154K, L452R, E484Q, D614G, P681R, Q1071H, and H1101D (Global Initiative on Sharing All Influenza Data [GISAID] database accession no. EPI_ISL_1379889). This sequence clustered with the other L452R- and E484Q-containing B lineage sequences in GISAID, comprised of 64 sequences primarily from India (59.4%, 38/64) and the United Kingdom (34.4%, 22/64) (Fig. 1B).

The nearest neighbor as of 25 March 2021 was hCoV-19/England/CAMC-1322E9F/2021|EPI_ISL_1246284|2021-02-22. The earliest date of collection was a specimen from India, sequence hCoV-19/India/MH-NEERI-NGP-26041/2020|EPI_ISL_1360304|2020-12-05, collected on 12 December 2020. These sequences are distinct from the B.1.427/B.1.429 lineage (Fig. 1C). The four additional cases were subsequently confirmed by whole-genome sequencing and contain the same set of spike mutations (see Table 1 for GISAID accession numbers).

TABLE 1TABLE 1 SARS-CoV-2 GISAID accession numbers for samples sequenced in this study

Case no.Sequence nameGISAID accession no.Date of collectiona
1hCoV-19/USA/CA-Stanford-12_S42/2021EPI_ISL_13798892021-03-01
2hCoV-19/USA/CA-Stanford-15_S02/2021EPI_ISL_16752232021-03-05
3hCoV-19/USA/CA-Stanford-15_S12/2021EPI_ISL_16752242021-03-12
4hCoV-19/USA/CA-Stanford-15_S27/2021EPI_ISL_16752252021-03-16
5hCoV-19/USA/CA-Stanford-17_S23/2021EPI_ISL_17016792021-03-12

The L452R and E484Q mutations are located in the RBD, and viruses harboring these individual mutations have reduced susceptibility to monoclonal antibodies, including bamlanivimab, as well as convalescent plasma (2–8). The combined impact of these mutations on neutralization and vaccine efficacy remains to be determined. This case illustrates the critical nature of assay review and investigation and highlights the rapidity with which potential variants of concern can be transmitted worldwide.

reference link : https://journals.asm.org/doi/10.1128/JCM.00741-21

LEAVE A REPLY

Please enter your comment!
Please enter your name here

Questo sito utilizza Akismet per ridurre lo spam. Scopri come vengono elaborati i dati derivati dai commenti.