Materials scientists widely incorporate hydroxyapatite (HA) for bone repair in bone tissue engineering (BTE) due to its superior biocompatibility as a natural component of human bones and teeth.

In a recent report on Science Advances, a research team highlighted the proliferation-suppressive effect of HA nanoparticles (n-HA) against a variety of cancer cells by combining the translational value of n-HA as a bone-regenerating material and an anti-tumor agent.

In the study, Kun Zhang and an interdisciplinary research team in the departments of Orthopedic Surgery, Dermatology, Biomedical Metal Materials and the National Engineering Research Center for Biomaterials in China, demonstrated the inhibition of tumor growth, metastasis prevention and the enhancement of the survival rate in tumor-bearing rabbits treated with n-HA.

They confirmed activation of the mitochondrial-dependent apoptosis pathway in vivo and observed a stimulated immune response to n-HA induced antitumor effects.

The research team then loaded a porous titanium scaffold with n-HA and implanted it into a critical-sized segmental bone defect in a rabbit tumor model for translational studies.

Based on the results, they verified the ability of the n-HA releasing scaffold to suppress tumor growth and osteolytic lesion while promoting bone regeneration.

The research findings provide a strong rationale to use n-HA to regenerate tumor-associated bone segmental defects in vivo.

In the United States, approximately 2,500 new cases of primary bone cancer are diagnosed annually with approximately half the patients exhibiting bone metastasis.

During standard clinical treatment of bone cancers, the surgical approach includes resection and reconstruction of the affected bone, followed by adjuvant radiation or chemotherapy.

Although load-bearing artificial implants are currently adopted in clinical practice, poor implant-bone osseointegration and the difficulty of new bone formation in a tumor environment remain major challenges for orthopedic surgeons.

Incomplete surgical resection of the affected tissue can also risk the spread of tumor cells to result in 8 percent recurrence or metastases.

As a result, researchers urgently aim to develop an implant that combines antitumor activity and bone regeneration functions.

Since the 1970s, clinicians have applied HA-based biomaterials clinically during orthopedic and dental repair.

Materials scientists have also developed surfaces modified with HA as prosthetic metal implants for enhanced bone integration.

Notable research studies have shown the capacity of n-HA to inhibit cancer cell proliferation and induce apoptosis, including osteosarcoma cells, breast cancer cells, colon cancer cells and liver cancer cells, while sparing normal cells.

Preceding studies provided insight to the mechanism of n-HA antitumor activity based on in vitro experiments, although much remains to be known of the underlying mechanism in vivo.

Application of hydroxyapatite nanoparticles (n-HA) in tumor-associated bone segmental defect

Characterization of particles and scaffold. (A) XRD (X-ray diffraction) patterns of n-HA, μ-HA, and n-TiO2 particles. The standard spectra of HA, anatase TiO2, and rutile TiO2 are given below. a.u., arbitrary units. (B) Representative TEM image of n-HA, SEM image of μ-HA, and TEM image of n-TiO2. (C) SEM images of 3D-printed porous titanium scaffold subjected to acid-alkali treatment, coated with n-HA and surface/cross-sectional alignment of n-HA with EDS confirmation.

The dotted yellow line indicates the interface between n-HA coating and scaffold.

The yellow arrow marks the average thickness of n-HA layer. Ca/P indicates atomic molar ratio of the selected region. (D) Weight change of particles released from n-HA/scaffolds immersed in tris-HCl solution for 7 days. Error bars represent SD. n = 3 replicates. (E) Representative TEM image of the released n-HA particles. (F) XRD pattern of the released n-HA particles. The asterisk indicates characteristic peaks of HA. Credit: Science Advances, doi: 10.1126/sciadv.aax6946

Testing the new experimental strategy in the lab

In the present work, Zhang et al. presented an unprecedented strategy to combine bone tumor treatment using a 3-D printed titanium scaffold modified with n-HA for antitumor function.

They conducted in vitro co-culture experiments first, to demonstrate the ability of the synthetic, rod-shaped n-HA to induce apoptosis in the malignant VX2 tumor cells. Thereafter, the research team implemented an intramuscular tumor model in immunocompetent rabbits to show the suppression of tumor development and reduced metastasis.

Researchers initially observed and reported the anti-tumor effect of n-HA in 1993, when they serendipitously found a control group of pure n-HA to inhibit Ca-9 cancer cell lines further validated in 2003 using functional studies in vitro. In the present work, Zhang et al. used µ-HA and n-TiO2 particles as control groups alongside n-HA to determine if the antitumor effect originated from the material composition or particle size.

For this, they used X-ray diffraction analysis (XRD) and confirmed similarities of the HA phase composition between n-HA and µ-HA. Then using transmission electron microscopy (TEM) images they revealed the rod shape of n-HA and used scanning electron microscopy (SEM) micrographs to observe µ-HA.

They then engineered porous titanium scaffolds using selective laser sintering to satisfy the load-bearing requirements for rabbit cortical bone replacement. Zhang et al. enhanced the bioactivity of the printed scaffolds using acid-alkali treatment and achieved n-HA coating using a combined method of slurry foaming and impregnation. The scientists characterized (tested) the scaffolds to determine the surface chemistry and kinetics of n-HA release in an acidic environment.

Application of hydroxyapatite nanoparticles (n-HA) in tumor-associated bone segmental defect

LEFT: In vitro tumor cell viability and apoptosis cocultured with different particles. (A) VX2 cells viability determined by CCK-8 assay when cocultured with n-HA, μ-HA, and n-TiO2 for 1, 3, and 5 days. Error bars represent SD. *P < 0.05 compared to 0 μg/ml; †P < 0.05 compared to 1000 μg/ml; P values were calculated using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. n = 3 biological replicates. OD, optical density. (B) Representative fluorescent images of VX2 cells stained with fluorescein diacetate (green) and (C) nucleus stained with 4′,6-diamidino-2-phenylindole (blue) treated with n-HA, μ-HA, and n-TiO2 at different concentrations for 3 days. Arrowheads indicate condensed chromatin. (D) Representative dot plots of annexin V fluorescein isothiocyanate (FITC) apoptosis detection results of VX2 cells treated with n-HA, μ-HA, and n-TiO2 at different concentrations for 3 days. RIGHT: n-HA inhibits the tumor growth and metastasis in rabbits. (A) A diagram depicts the arrangement of left and right flanks of the experimental rabbits. (B) MRI of the tumor-bearing rabbits administered with n-HA, μ-HA, or n-TiO2 (right flank) for 3 weeks. Left flank served as control (Ctrl). (C) Photographs of excised tumor tissues at week 4. (D) Quantification of the excised tumor volume at week 4. Error bars represent SD. n = 4 biological replicates. **P < 0.01; P value was calculated using one-way ANOVA followed by Tukey’s post hoc test. (E) Representative hematoxylin and eosin (H&E) staining of tumor tissues treated with n-HA, μ-HA, and n-TiO2 at week 4. T, tumor tissue; M, muscle tissue adjacent to tumor; *, materials; arrow, FBGCs. Scale bars, 10 mm (column 1), 200 μm (column 2), 50 μm (column 3), and 20 μm (column 4). (F) TEM images of tumor tissues treated with n-HA, μ-HA, and n-TiO2 at week 4. Scale bars, 2 μm (column 1) and 500 nm (column 2). The SAED of the particles confirmed the existence of n-HA and n-TiO2 near cell nucleus. N, nucleus. (G) Survival rate of the rabbits upon different particles treatment. n = 4 per group. (H) H&E staining of the major organs collected from one side of tumor-bearing rabbits administered with n-HA, μ-HA, n-TiO2, or vehicle (Ctrl) at week 4. Scale bars, 500 μm (column 1) and 200 μm (other columns). Photo credit: Kun Zhang, National Engineering Research Center for Biomaterials, Sichuan University. Credit: Science Advances, doi: 10.1126/sciadv.aax6946
Testing the biocompatibility and cancer cell apoptosis with different particles.

To test in vitro antitumor activity and toxicity of the particles, the researchers chose a wide range of n-HA concentrations to co-culture with VX2 tumor cells or normal L929 fibroblast cells. During prolonged experiments n-HA reduced the viability of tumor cells, although comparatively, µ-HA did not reduce the viability of either cell type, while n-TiO2 decreased the viability of VX2 and inhibited L929 cell growth with prolonged time.

When Zhang et al. tested the in vivo antitumor ability of n-HA, they used an intramuscular VX2 tumor model on both flanks (right and left) of the rabbit, and administered n-HA, µ-HA and n-TiO2 on either side. By week three, they used magnetic resonance imaging (MRI) of individual animals to show reduced HA-treated tumor size in the right hand side, compared to the control in the left hand side. Comparatively neither µ-HA nor n-TiO2 showed tumor growth suppression in vivo during the same period.

The scientists harvested the tumor samples at week 4 to confirm the antitumor ability of n-HA using histological staining at the interface of the tumor and muscle tissue. They noted diverse immune cells surrounding the n-HA particles, such immune diversity was not observed surrounding µ-HA and n-TiO2 coated scaffolds. Using TEM observations, Zhang et al. showed both n-HA and n-TiO2 internalized within tumor cells. Histological findings at week 4 indicated the prevention of metastasis to the lung with n-HA animal groups, although similar observations were not recorded with µ-HA or n-TiO2. Metastasis elimination in rabbits treated with n-HA led to longer survival rates and lower rates of tumor positive cells compared to those treated with other materials.

Application of hydroxyapatite nanoparticles (n-HA) in tumor-associated bone segmental defect

LEFT: Activation of mitochondrial apoptosis pathway by n-HA. (A) Longitudinal observation of the excised tumor treated with n-HA from weeks 2 to 5 (2W to 5W). Ctrl, left flank control without any treatment. (B) Quantification of the excised tumor volume. Error bars represent SD. n = 4 per group. (C and D) Expressions of mitochondrial apoptosis-related markers in tumor tissues measured by Western blotting (WB) at week 4. VEGF, vascular endothelial growth factor; GAPDH, glyceraldehyde phosphate dehydrogenase. Error bars represent SD. n = 3 per group. (E) Immunohistochemical analyses of Ki-67, Cyt C, p53, Bcl-2, and Bax and TUNEL assay of tumor tissues treated with n-HA at week 5 in comparison with control. Scale bar, 50 μm. *P < 0.05, **P < 0.01 compared to control, two-way t test. Photo credit: Kun Zhang, National Engineering Research Center for Biomaterials, Sichuan University. RIGHT: n-HA regulates gene expressions related to tumor suppression, calcium homeostasis, and immune response. (A) Volcano plot showing differentially regulated genes in the n-HA–treated tumor tissue as compared to the nontreated control. Genes with an absolute fold change of >2 and a P value of <0.05 are highlighted in green and red, denoting down- and up-regulated genes, respectively. (B) Gene set enrichment analysis of the regulated gene pathways with the Kyoto Encyclopedia of Genes and Genomes database. NES, normalized enrichment score. (C) Circular visualization of the results of gene-annotation enrichment analysis. (D) Heat map of genes that were differentially expressed in n-HA versus control tumor tissues with a fold change of >2 and a P value of <0.05. (E) Enzyme-linked immunosorbent assay of inflammatory cytokines secreted by mouse RAW 264.7 macrophages into culture medium (macrophages conditioned medium) after 3 days of coculturing with n-HA. *P < 0.05, **P < 0.01 compared to control, two-way t test. Error bars represent SD. n = 3 biological replicates. TGF-β, transforming growth factor–β; FGF, fibroblast growth factor. (F) Wound healing assay of mouse 4T1 tumor cells treated with control medium (Ctrl), n-HA, macrophages conditioned medium (CM), or macrophages conditioned medium with n-HA (CM@n-HA) for 24 hours. (G) Transwell assay after crystal violet staining showing serum-induced migration of 4T1 tumor cells treated with Ctrl, n-HA, CM, or CM@n-HA for 24 hours. Credit: Science Advances, doi: 10.1126/sciadv.aax6946
Investigating the anti-tumor mechanisms of n-HA

After several weeks, the scientists analyzed the mitochondrial apoptosis pathway activation of the tumor tissue by n-HA using immunohistochemistry (IHC), nitric oxide synthase experiments and protein expression studies using Western blotting.

They observed reduced protein expression of Ki-67 and increased expression of TUNEL (terminal deoxynucleotidyl transferase) for reduced cell proliferation and induced apoptosis.

They also noted higher expression of the p53 protein in the n-HA group in response to cellular stress to suppress oncogenesis. And observed a significant increase for n-HA induced Bcl-2 associated X protein (BAX) – a proapoptotic protein while lowering Bcl-2 an anti-apoptotic protein in the mitochondrial apoptotic pathway.

Together, the proteins regulated the release of proapoptotic factor cytochrome C (cyt C) from the mitochondria into the cytosol for cell apoptosis.

Zhang et al. further investigated potential antitumor mechanisms of n-HA by performing an mRNA expression profile microarray and confirmed the expression of several genes using qRTPCR (quantitative reverse transcription polymerase chain reaction). They found that n-HA significantly upregulated the expression of tumor apoptosis related genes; suggesting the activation of the extrinsic death receptor apoptosis pathway via n-HA.

The scientists identified multiple mechanistic pathways using databases such as Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO).

The results showed the influence of n-HA interference on multiple aspects of the tumor microenvironment to suppress tumor promoting functions.

Application of hydroxyapatite nanoparticles (n-HA) in tumor-associated bone segmental defect

Antitumor and segmental bone defect healing ability of n-HA–loaded titanium scaffold. (A) Diagram depicting the preparation of tumor cell suspension and seeding into scaffold. (B) Implantation of tumor cell–seeded scaffold at segmental bone defect of rabbit femur. (C) Tumor volume of the rabbits implanted with empty scaffolds or n-HA/scaffolds within 5 weeks. Error bars represent SD. n = 4 per group. **P < 0.01 compared to empty scaffold, two-way t test. (D) Photographs of excised implants with tumor from weeks 2 to 5. (E) Micro-CT–reconstructed images of the implants and adjacent bone tissue. B, bone; S, scaffold; arrows show adjacent cortical bone resorption by tumor. (F) Histological observation of the implanted scaffolds. S, scaffold; T, tumor; red arrows indicate new bone formation. Photo credit: Yong Zhou, Department of Orthopaedic Surgery, West China Hospital of Sichuan University. Credit: Science Advances, doi: 10.1126/sciadv.aax6946.
Conducting segmental bone defect repair with n-HA/scaffolds in a tumor environment
The scientists then completed wound healing assays to identify if secretory inflammatory cytokines such as TNFα (Tumor Necrosis Factor Alpha) were released from macrophages as a result of n-HA stimulation to inhibit tumor cell migration.

They confirmed that cytokine secretion by macrophages upon stimulation with n-HA could decrease tumor cell migration. When the research team completed segmental bone defect repair with a n-HA/scaffold in a tumor microenvironment of a rabbit model thereafter, they observed a 73.8 percent reduction in the tumor volume of rabbits with the n-HA loaded scaffold implant.

Histological studies showed the pores of the empty scaffold filled completely with tumor cells, while fewer tumor cells aggregated in the n-HA/scaffold.

The n-HA coated implants suppressed tumor growth and promoted bone regeneration with ability to eventually dissolve into calcium and phosphorous ions for gradual replacement by new bone in vivo.

In this way, Kun Zhang and colleagues established a rabbit femur bone tumor model with VX2 and demonstrated the n-HA coating effects in tumor growth suppression, alongside their safety for bone regeneration relative to normal cells and tissue. Although the results are promising in a translational animal model, the effects of n-HA in a clinical environment remain to be determined.

The research team will launch clinical trials with n-HA coated hydrogels for post-surgical cancer treatment for promising clinical outcomes of biosafety and anti-tumor capabilities.

They then aim to implement a series of n-HA shape/crystallinity-dependent experiments to comprehend the compound’s mechanism of action, based on the diverse physical and chemical properties of n-HA variants.


As the largest organ and outer shell of human body, skin mainly protects tissues and organs in the body from the attack of physical factor, chemical substance, mechanical stress, and pathogenic microorganism.1,2 

In the epidermal layer of skin, there are five layers from inside to outside, in which the melanocytes in the basal layer are susceptible to lesions and then transform into melanoma.3,4 

In recent years, melanoma took on the increasing incidence rate and can also be found in mucosa, choroid, and other tissues.59 

So far, the general clinical treatment is still surgical resection, accompanied by chemotherapy and immunotherapy.

However, melanoma has the characteristics of rapid proliferation, local invasion, long-distance migration, and strong resistance to currently clinical therapies.1,10 

Except the thin primary skin melanoma (<1 mm), the clinical surgery for metastatic melanoma and deep primary malignant melanoma (>4 mm) still have a very high recurrence rate and mortality.11,12 

Therefore, new strategies for improving the clinical treatment effect of melanoma are quite necessary.

Hydroxyapatite (HA) is a major inorganic component of human bone and teeth, and exhibits excellent biocompatibility, bioactivity, osteoconduction, and even osteoinduction in biomedical application.1315

 In 1990s, Aoki et al and Kano et al first reported the in vitro anti-tumor effect of HA nanoparticles (HANPs).16,17 

They occasionally found that HANPs without loading doxorubicin still had the inhibitory effect on the proliferation for Ca-9 tumor cells.

After that, the anti-tumor effects of HANPs were widely regarded and investigated.

A large number of reports indicated that HANPs could inhibit the proliferation of various tumor cells, such as hepatoma cells,1820 osteosarcoma cells,2123 lung cancer cells,24,25 and gastric cancer cells2628 to some extent.

Moreover, HANPs showed little or no inhibitory effect on the normal tissue cells, including osteoblasts,23 hepatocytes,18 lung fibroblasts,25 etc.

This was undoubtedly hopeful to overcome the drawbacks of some anti-tumor drugs, which could kill cancer cells as well as normal tissue cells.

In previous studies, Li et al reported that HANPs had certain anti-melanoma effect.29 

They found that for HANPs, the size had stronger influence on the proliferation of A875 melanoma cells than the morphology.

However, the involved mechanism has not been well revealed.

Besides, the correlation between the material factors of HANPs and proliferation inhibition or apoptosis of melanoma cells need be further investigated.

Hence, in the present study, we prepared five different HANPs by wet chemical method combining with polymer template and different post-treatments, and investigated their anti-melanoma effects by in vitro and in vivo experiments.

Besides, human fibroblasts were chosen as the control to investigate their impacts on normal tissue cells.

The influences of various material factors on the anti-melanoma effects of the HANPs were studied systematically and discussed.

Reagents

Ca(NO3)2·4H2O, (NH4)2HPO4, and NH3·H2O were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). PEG2000 was purchased from the Aladdin (Shanghai, China). Human melanoma cells (A375) and human epidermal fibroblasts (HSF) were purchased from iCell Bioscience Inc (Shanghai, China). FBS, DMEM medium, penicillin–streptomycin solution, PBS, and Trypsin 0.25% EDTA were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Fluorescein diacetate and propidium iodide (PI) were purchased from Sigma-Aldrich Co. (St Louis, MO, USA). DAPI was purchased from Beyotime (Shanghai, China). Cell Counting Kit-8 (CCK-8) was purchased from Dojindo Laboratories (Kumanoto, Japan). Fluorescein isothiocyanate (FITC) Annexin V Apoptosis Detection Kit I was purchased from BD (Franklin Lakes, NJ, USA). The RNeasy Mini Kit was purchased from Qiagen (Hilden, Germany). The iScript™ gDNA Clear cDNA Synthesis kit and SsoFast™ EvaGreen Supermix were purchased from Bio-Rad Laboratories Inc. (Hercules, CA, USA). The Matrigel was purchased from Corning Incorporated (Corning, NY, USA).

Preparation of HANPs

HANPs were synthesized at room temperature by wet chemical method using reactive system of Ca(NO3)2·4H2O and (NH4)2HPO4, in which NH3·H2O was used for pH adjustment and PEG2000 as a template reagent. The molar ratio of Ca/P was maintained at 1.67. A certain amount of PEG2000 solution (8.0 wt%) was added to Ca(NO3)2·4H2O solution, and then (NH4)2HPO4 solution was added dropwise to the solution, whose pH was kept at ~10.0 by addition of NH3·H2O. After that, the stirring for mixing the solution continued for a period of time, and then the slurry was aged at room temperature for 24 hours. Next, the slurries were washed with ultrapure water to neutrality. With or without post-treatment, the slurries were dried at 60°C for 10 hours. Various preparing parameters for HANPs, including the concentration of reactants and the post-treatment of the slurries are summarized in Table 1. In total, five HANPs, ie, HA-A, HA-B, HA-C, HA-D, and HA-E, were prepared for subsequent experiments.

Table 1

The preparing parameters for the five HANPs

SamplesCa2+concentrationPost-treatment
HA-A0.50 MDrying directly at 60°C in an oven
HA-B0.50 MHydrothermal treatment at 120°C for 12 hours, then drying at 60°C in an oven
HA-C0.50 MHydrothermal treatment at 150°C for 12 hours, then drying at 60°C in an oven
HA-D0.50 MDrying at 60°C in an oven, then calcinating at 700°C for 1 hour in a muffle furnace
HA-E0.10 MDrying directly at 60°C in an oven

Abbreviation: HANP, hydroxyapatite nanoparticle.

Characterization of HANPs

The phase composition of HANPs was determined by X-ray diffraction (XRD, Shimazu XRD-6100, Kyoto, Japan) using Cu Ka radiation (λ=1.5418 Å) with the test voltage at 40 kV and the operating current at 30 mA. The diffraction spectrum was scanned from 20° to 60° with a speed of 5°/min. Patterns were analyzed by using Jade 6.0 software. The crystallinity of HANPs was calculated using the following Equation 1, where β002 is the full width at half maximum of the (002).30,31

Xc=(0.24/β002)3 (1)

The chemical groups of HANPs were analyzed by Fourier-transform infrared spectroscopy (FTIR, Nicolet 6700; Thermo Fisher Scientific) with the range from 4,000 to 400 cm−1.

The morphology and particle size of HANPs were observed by Transmission Electron Microscope (TEM, FEI; Tecnai G2F20, Hillsboro, OR, USA) at the working voltage of 200 kV. The morphology of the NPs was observed by dropping HANPs dissolved onto a copper grid. The particle size of HANPs was measured by using Nano Measurer. When measuring the particle sizes, we selected at least three images of as-prepared five HANPs at the scale of 200 nm, and at least 70 particles in each image were evaluated for statistical analysis.

Zeta potentials of HANPs were measured by a Nano Zetasizer (ZS90; Malvern Instruments, Malvern, UK) based on dynamic light scattering theory. The specific surface areas (SSAs) of HANPs were determined by Brunauer–Emmett– Teller method using a surface area analyzer (GeminiVII 2390 t; Micromeritics Instrument Corporation, Norcross, GA, USA). The releases of Ca2+ from HANPs were measured by ICP-AES (ARCOS; Spectro Analytical Instruments GmbH, Kleve, Germany). Simply, the five HANPs were dispersed in Tris-HCl solution (pH7.4) at the concentration of 200 μg/mL and then placed in a 37°C incubator for 3 days. Next, the supernatants were collected and analyzed.

Cell culture

Both A375 and HSF cells were cultured in DMEM medium supplemented with 1% penicillin and streptomycin and 10% FBS at 37°C under 5% CO2 atmosphere. After the cells grew to 70%–80% confluence in tissue culture flasks, the cells were digested with 0.25% trypsin containing EDTA and counted, followed by seeding in a 24-well plate with a density of 104 cells per well. The HANPs suspensions with different concentrations (100, 200, and 400 μg/mL) were prepared by dispersing the NPs in DMEM. After cell attachment, the HANPs suspension was added into each well. Then, the cells were subjected to the subsequent analysis after culturing for 1, 2, and 3 days.

CCK-8 analysis

Cell viability was evaluated by CCK-8 method. After culturing A375 or HSF cells with various HANPs for the set times, the media were removed, followed by addition of fresh DMEM medium, including water-soluble tetrazolium (WST)-8 (WST-8/DMEM =1/9). After keeping in a dark place for 2 hours, the OD value in all wells were measured by a microplate reader (EON; BioTek, Winooski, VT, USA) at the wavelength of 450 nm. The cells without addition of HANPs were used as the control group. Three duplicates for each group were used in the test, and cell viability (%) was calculated according to Equation 2.Cell viability (%)=[OD]test−[OD]blank[OD]control−[OD]blank(2)

Confocal laser scanning microscopy (CLSM) observation

After culturing A375 or HSF cells with various HANPs for the set times, the media were removed, then the cells were washed with PBS (pH 7.4) and fixed with 4% paraformal-dehyde for 20 minutes, followed by staining with DAPI for 10 minutes in the dark. The nuclear morphology of the cells was examined by CLSM (Leica-TCS-SP5; Leica Microsys-tems, Wetzlar, German), and the cell nucleus was dyed blue.

Flow cytometer

The apoptosis of A375 cells was analyzed by flow cytometer (CytoFLEX; Beckman Coulter, Guangzhou, China). After culturing with the HANPs for the set times, the cells were double stained with Annexin V FITC/PI. The normal, apoptotic, and necrotic cells were examined. FITC and PI staining were performed according to the manufacturer’s instructions. A375 cells in different states were mapped in a bidirectional dot plot.

PCR analysis

After culturing with the HANPs for the set times, RNA of the cells (A375 or HSF) was isolated using RNeasy Mini Kit. The cells were fully lysed using Buffer RLT, and the centrifuged RNA samples were added to the DNase reagent to remove genomic DNA contamination. The extracted RNA was reversely transcribed into cDNA using the iScriptTM gDNA Clear cDNA kit. The resulting cDNA was then amplified using the SsoFastTM EvaGreen® kit. Three parallel samples were set for each target gene. The PCR reaction was performed using a CFX96™ system (Bio-Rad), and the data were processed and analyzed by CFX Manager software. The target gene expression level was calculated by 2−ΔΔCt method, and glyceraldehyde-3-phosphate dehydrogenase was used as the internal reference gene to normalize the result. Primer sequences in the present study are shown in Table 2.

Table 2

The primer sequences for the apoptotic-related genes

GenePrimerSequence (5′ to 3′)Gene bank identification
GAPDHForwardGCCAAGGCTGTGGGCAAGGTNM_002046
ReverseAGGTGGAGGAGTGGGTGTCG
Caspase-3ForwardATAAGGAAAGCAATAAATGAATGGNM_032991
ReverseCAGTGCGTATGGAGAAATGGG
Caspase-8ForwardTTTTATTCAGGCTTGTCAGGGNM_001228.4
ReverseCTGGCAAAGTGACTGGATGTA
Caspase-9ForwardTGGTTCTGGAGGATTTGGTGANM_001229
ReverseCGACGCCGCAACTTCTCACA
Bcl-2ForwardTGCGTCCTACAGATACCACAANM_004049.3
ReverseATGATGCCGTCTTCAAACTCC
BaxForwardGCTTCAGGGTTTCATCCAGGNM_138761
ReverseCACGGCGGCAATCATCCTCT
p53ForwardTGTGCCTTGCCAGTGGGATTCNM_001141980
ReverseAGGATTTTCACGGGGTTGCCA

Abbreviation: GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Animal study

In the present study, 15 BALB/C nude mice (female, 14–16 weeks old, weighing 20.0±1.0 g) purchased from Laboratory Animal Center of Sichuan University (Chengdu, China) were used for animal study. The animal experiments were approved by the Animal Care and Use Committee of Sichuan University and followed the guidelines of the Chinese Society of Laboratory Animals on animal welfare. The nude mice were randomly divided into three groups, ie, one control group and two experimental groups. Based on the aforementioned in vitro evaluation, HA-A and HA-C were selected as the experimental materials. According to 1 mg/mL concentration, the HANPs suspension was prepared by dispersing 50 mg HANPs into 50 mL DMEM. After A375 cells grew to 70%–80% confluence in tissue culture flasks, the cells were trypsinized and the cell suspension was collected. Then, the cell suspension containing 2×106cells were transferred into a centrifuge tube and centrifuged at the speed of 1,000 rpm, followed by adding 1 mL HANPs suspension (or DMEM for control group) and 10 μL commercial Matrigel. The mixture was subcutaneously injected into the left side of the nude mouse after blending thoroughly. Therefore, the injection dose of HANPs in each mouse in the experimental groups was 50 mg/kg weight. The formation and volume change of tumor tissue in the animal was observed and recorded. The length and width of the formed tumor tissue in each animal and each time point were measured by caliper, and the tumor volume was calculated according to Equation 3:

Tumor volume(mm3)=ab2/2(3)

where a and b represented the largest length and width of the formed tumor tissue, respectively.32

Statistical analysis

Statistical analysis was performed with one-way ANOVA using SPSS13.0 software. All data were expressed as mean ± SD and obtained by at least three replicates for each data set. The level of P<0.05 was considered to be statistically significant.

Results

Characterization of HANPs

Figure 1A shows the XRD patterns of the as-prepared five HANPs. The characteristic peaks in the five HANPs were consistent with those in the HA standard (JCPDS: 09-0432), indicating that all of them were composed of pure HA phase. In the three samples with different post-treatments (HA-B, HA-C and HA-D), the three diffraction peaks, which respectively corresponds with (211), (112) and (300) crystal faces, were obviously sharp. However, in other two directly dried samples (HA-A and HA-E), they were partly fused. Figure 1B shows the infrared spectra of the as-prepared five HANPs. In all the samples, two characteristic peaks corresponding with OH and PO43− groups in HA could be seen clearly. The vibration peaks of OH appeared at about 3,560 cm−1.33 There were two weak peaks ranging from 550 cm−1 to 650 cm−1, which could be the stretching vibration peaks of PO43− bond. The band between 1,120 cm−1 and 940 cm−1 belonged to the strong and broad peaks of PO43−.33,34 Except for HA-D, the other four HANPs showed the characteristic peak of CO32− at about 1,460 cm−1 and 870 cm−1. This could be attributed to CO2 in the air entering the solution and participating in the precipitation of HANPs, leading to formation of B-HA.3335 As for HA-D, the calcination process could result in the loss of CO32−. Besides, there was a very weak tensile vibration peak at about 1,650 cm−1, indicating that the as-prepared HANPs could contain the crystal water.33,35

An external file that holds a picture, illustration, etc.
Object name is ijn-14-1177Fig1.jpg

Figure 1 X-ray diffraction patterns (A) and Fourier-transform infrared spectra (B) of the as-prepared five HANPs.

Abbreviation: HANP, hydroxyapatite nanoparticle.

Figure 2 shows the TEM images of the as-prepared five HANPs, and Table 3 summarizes their physicochemical properties. They all were nano-scaled particles but had different morphologies and sizes. Both HA-A and HA-D had granular shapes, but their average particle sizes were about 20 and 50 nm, respectively. HA-E was needle-like, and its average diameter and length were about 5 and 40 nm, respectively. Both HA-B and HA-C were rod-like, but HA-B had a little larger diameter and length than HA-C. All the five HANPs had negative zeta potentials, indicating that they had negative surface net charges. Based on the XRD analysis, HA-A and HA-E had far lower crystallinity than the other three HANPs, indicating that the hydrothermal or calcinating process could improve the crystallization of the synthesized HANPs. Likely, SSA of HANPs was also influenced by the post-treatments. HA-A and HA-E had far higher SSA than the other three HANPs. However, the calcinated HA-D had lower crystallinity and SSA than the hydrothermal treated HA-B and HA-C. Under two different hydrothermal treatments, no obvious difference of crystallinity and SSA was found between HA-B and HA-C.

An external file that holds a picture, illustration, etc.
Object name is ijn-14-1177Fig2.jpg

Figure 2 – The typical transmission electron microscope images of the as-prepared five HANPs.

Abbreviation: HANP, hydroxyapatite nanoparticle.

Table 3

The physicochemical properties of the as-prepared five HANPs

Physicochemical propertiesSamples
HA-AHA-BHA-CHA-DHA-E
MorphologyGranularRod-likeRod-likeGranularNeedle-like
Particle size (nm)17.41±1.16L:61.26±6.38L:45.13±8.8547.58±7.04L:39.29±6.05
D:29.08±5.26D:25.24±2.12D:5.88±0.74
Crystallinity (%)12.8072.8973.2952.5720.00
Zeta potential (mV)−9.62±0.65−10.90±0.91−12.50±0.78−16.60±0.60−10.60±0.69
SSA (m2/g)107.38±0.0648.64±0.3151.27±7.1926.45±0.4989.90±16.87
[Ca2+] (ppm)7.09±0.532.82±0.031.98±0.052.92±0.068.04±0.23

Abbreviation: HANP, hydroxyapatite nanoparticle.


More information: Kun Zhang et al. Application of hydroxyapatite nanoparticles in tumor-associated bone segmental defect, Science Advances (2019). DOI: 10.1126/sciadv.aax6946

Yingchao Han et al. Different Inhibitory Effect and Mechanism of Hydroxyapatite Nanoparticles on Normal Cells and Cancer Cells In Vitro and In Vivo, Scientific Reports (2014). DOI: 10.1038/srep07134

J. Yang et al. The enhanced effect of surface microstructured porous titanium on adhesion and osteoblastic differentiation of mesenchymal stem cells, Journal of Materials Science: Materials in Medicine (2013). DOI: 10.1007/s10856-013-4976-4

Journal information: Science Advances , Scientific Reports

LEAVE A REPLY

Please enter your comment!
Please enter your name here

Questo sito utilizza Akismet per ridurre lo spam. Scopri come vengono elaborati i dati derivati dai commenti.