The spread of COVID-19 is monitored using swabs to collect respiratory fluids of nasopharyngeal origin on which the presence of the virus will be tested.

The biological material taken with the swab is sent to an accredited analysis laboratory, where the extraction of the RNA is carried out and through a technique called on the RT-PCR (Reverse Transcriptase – Polymerase Chain Reaction or Reverse Transcriptase – Polymerase Chain Reaction) , whether the presence of the virus is detected or not.

Although rRT-PCR is a highly sensitive test, its reliability is not complete.

It is well known that this technology, like all molecular technologies used in diagnostics, has the possibility of false positives and negatives, the percentages of which should be carefully defined during the validation of the test.

The key reagents for performing the rRT-PCR test, namely the oligonucleotide primers and the probe, are drawn on conserved regions of the SARS-CoV-2 viral genome, but coronaviruses exhibit frequent mutation and recombination events.

How these eventual events may affect the sensitivity of the test, especially over time, cannot be known.

Additionally, low viral loads in asymptomatic or mildly symptomatic patients may not be reliably detected by rRT-PCR.

Let’s try to understand how RT-PCR (Reverse Transcriptase – Polymerase Chain Reaction) works and how they technically work.

What is the RT-qPCR test?

The polymerase chain reaction (PCR) is a highly sensitive and specific method for the amplification and detection of deoxyribonucleic acid (DNA) [1].

Its conceptual simplicity has made it the most widely used technique in molecular biology and can, in theory, detect even a single fragment of DNA. Therefore, it is widely used as a diagnostic test for a wide range of bacterial, fungal, viral and parasitic pathogens.

However, the coronavirus genome is made up of ribonucleic acid (RNA) rather than DNA.

Although RNA is similar to DNA, it differs enough in that Taq polymerase, the standard enzyme used for DNA amplification, only replicates it very inefficiently.

As a result, RNA is detected by a variant of the PCR test, called reverse transcription (RT) -PCR [2].

This comprises a two step method, typically comprising two enzymes; the first step uses an RNA-dependent DNA polymerase, also known as reverse transcriptase, to copy the RNA into the DNA (cDNA), the second step then moves on to the use of Taq polymerase, which amplifies the cDNA as in a standard PCR test (Figure 1).

Figure 1 – Thermal profile of a typical RT-qPCR test run on a BioRad CFX qPCR instrument. Here, the RT step is performed at 50 ° C for 15 min, followed by a 3 min RT deactivation and polymerase activation Taqphase. RT is followed by the PCR step, which consists of a 5 s denaturation step, during which the DNA strands separate into single strands, and an annealing / polymerization incubation step at 60 ° C of 45 s, during which amplification primers (and detection probes) hybridize with single-stranded DNA templates and allow the polymerase to replicate the template, creating double-stranded DNA. During successful polymerization, the probe is moved and hydrolyzed, separating the fluorophore and quencher and releasing fluorescence. This process is repeated, usually about 40 times (40 cycles). A typical RT-qPCR run, as exemplified here, is completed in approximately 1 hour and 27 minutes. Since this is an RT-qPCR run,

For diagnostic purposes, it is more convenient to perform RT and PCR reactions in a single tube; for research use, the two steps are often performed in separate tubes. There is an alternative approach that uses Tth polymerase, a thermostable enzyme capable of replicating both RNA and DNA to perform both RT and PCR reactions [3], but this method tends to be less sensitive.

Most diagnostic tests use a particular version of the RT-PCR test, called fluorescence-based quantitative RT-PCR (RT-qPCR) [4] (Figure 2).




igure 2
Signal generation during an RT-qPCR test. The test reagents include a buffer, both enzymes, target-specific DNA primers, and a target-specific DNA probe labeled at one end with a fluorescent label and at the other with a quencher. The samples on the left and right contain the same primers and probe, but the one on the left contains the target RNA, while the one on the right does not. A. RT: Samples are incubated at approximately 50 ° C, which results in RT transcription of target-specific cDNA from one of the strand-specific primers on the left, with no reverse transcription on the right. B. Denaturation: Samples are heated to 95 ° C, which denatures the RNA but leaves the cDNA intact. C. Re-cooking: the temperature is lowered to about 60 ° C, with the actual temperature depending on the dosage. This allows both target specific primers and probe to bind to their respective targets on the left, while the primers and probe remain unbound on the right. D. Polymerization: This step can be combined with the annealing step. On the left, the polymerase extends DNA synthesis, initially from only one primer, but after the first cycle from both, and displaces and hydrolyzes any bound probes. This separates the fluorophore and the quencher and causes the emission of light if the fluorophore is excited at the appropriate wavelength. On the right, none of this occurs and no light is emitted. This first cycle is followed by an additional user-defined number of cycles, indicated by the dotted arrow leading back to step BE

One of the valuable advantages of RT-qPCR is the ease with which RNA in general and viral load in particular can be quantified, if adequate assay parameters are established and appropriate controls are included [5].

The quantitation cycle (Cq) is at the heart of accurate and reproducible quantification using RT-qPCR.

The fluorescence values ​​are recorded during each cycle and represent the amount of product amplified up to that point in the amplification reaction.

The more template there is at the start of the reaction, the fewer cycles it takes to reach a point where the fluorescent signal is first recorded as statistically significant above the background.

This point is defined as Cq and will always occur during the exponential phase of amplification.

Therefore, the quantification is not affected by any reaction components that become limited in the plateau phase [2].

However, it is important not to rely solely on Cq when reporting results, as Cq values ​​are subject to inherent variation between series [6] and should not be used without suitable calibration standards [5].

An obvious way to get reliable quantification is to include a known copy number RNA molecule as a peak with the RNA after extraction.

This would allow both a measure of quality control, since any deviation from the expected Cq would suggest some inhibition of the reaction, and determination of viral copy number relative to that peak.

 This makes it possible to report not only an infected / non-infected qualitative response, but also aim to include a viral load assessment to measure, for example, disease progression.

Ultimately, the reliability of RT-qPCR results depends on the standardization of measurements [7], especially when used as a diagnostic tool.

It is clear that the need to be able to compare results from a wide range of tests, instruments, different laboratories and different countries makes the development of reference materials, which would eventually be certified, essential to allow for harmonization of data.

Recent years have seen the advancement of digital PCR as a complementary approach to measuring nucleic acids which can be highly reproducible when performed at different times and when different primer sets target the same molecule, as in the case of SARS-CoV-2. [8].

Although the cost of instrumentation, throughput, infrastructure requirements and penetration of RT-dPCR cannot be compared to RT-qPCR, this method is likely to be useful as a confirmatory method for suspected cases of SARS-CoV-2 infection. [9, 10], especially when very low viral loads are detected.

What reagents are needed to run it?

A complete RT-qPCR test requires few components, each of which is available in abundance.

RNA extraction reagents use a number of standard chemicals, including guanidinium isothiocyanate and triton surfactants, and there is no shortage of RT, Taq polymerase, primers, and probes or components for the RT-qPCR buffer.

This makes the British government’s claim of a shortage of chemical reagents that delay adequate testing rather surprising.

Additionally, even if there is a temporary interruption of supplies, most laboratories are well stocked and, as with PCR protocols, significant reductions in the quantities of reagents used for testing are easily achieved.

 Many standard reactions are performed in 25 µl volumes, but it is perfectly feasible to achieve the same sensitivity and accuracy in reaction volumes as low as 5 µl.

As Table 1 shows, this leads to a significant decrease in the amount of enzyme and master buffer mix required, with the added benefit of a significant reduction in cost per test.

 A 25ml quantity of enzyme mix, sufficient for 10,000 tests, is priced at around £ 925 in the UK (PCRBio OneStep RT-qPCR master mix).

Table 1

Reduction of the amount of enzyme mix required for RT-qPCR assays by reducing the assay volumes.

Volume of RT-qPCRBlend / enzyme testEnzyme Blend / 10,000 tests
(µl)(µl)(ml)
2512.5125
105.050
52.525

Gray color – a contrast.

What other considerations are there?

Clinical laboratory testing has made significant progress since external quality assessments (EQAs) first identified problems comparing results between different clinical laboratories [15].

Today, there are standards developed by the International Organization for Standardization, including the 20166 series, which are specifically designed for in vitro molecular diagnostic testing, as well as standards such as ISO 20395: 2019, which lists the requirements for evaluating the performance of quantitation methods for sequences target of nucleic acids for qPCR and dPCR.

 The goal of these standards is to reduce the impact of external factors on test results, thus ensuring that patients get diagnoses that are as objective as possible.

The pre-analytical phase of molecular testing, which includes sample collection, handling and storage and the potential for sample contamination [16], as well as problems related to nucleic acid extraction [17], is a major source of errors in laboratory diagnostic tests.

Samples for the PCR test for COVID-19 are usually taken from the inside of the nose, mouth, or back of the throat, and careful sampling and preparation of nucleic acids are important pre-test considerations.

It is clearly necessary to maximize the likelihood of successful virus collection by meticulous sampling.

Furthermore, since RT-qPCR is inhibited by many substances present in human samples [18], it is important to use nucleic acid extraction methods that remove these inhibitors.

Obviously, both criteria are particularly crucial to avoiding false negative results.

It has also become apparent that some commercial test kits, and in particular probes and primers, have been contaminated with SARS-CoV-2 sequences, with important implications for false positive detection.

The efficiency of an RT-qPCR test is of paramount importance. There is a wide choice of enzymes that can perform the two steps and they all differ in their properties.

The RNA conversion step is notoriously variable and some combinations of RT-PCR enzymes are more efficient than others [19].

Because the PCR step amplifies the DNA exponentially, small differences in efficiency can cause large differences in the sensitivity of the assay.

Again, this is very important during the very early stages of the infection, when a swab can pick up very few viral particles.

The reliability of the assay also depends on the reagents used to allow the enzyme to amplify and detect its target.

These are the SARS-CoV-2 specific primers and probe, which must be 100% virus specific and then amplify only the viral sequences and report the increasing amount of synthesized PCR amplicon.

There are several viral genomic regions targeted by RT-qPCR assays and multiple primer models that target the same genes.

These include the RdRP gene (RNA-dependent RNA polymerase gene), the E gene (envelope protein gene) and the Ngene gene (nucleocapsid protein gene).

It is important to note that two different primer sets may both be 100% specific for their target, but exhibit different amplification efficiencies and thus result in different sensitivity of the assays [20].

This has been observed for SARS-CoV-2 assays, where differences in the performance of the various tests have been reported [21, 22] which may be due to differences in priming efficiency or protocols used, or may be associated with RNA secondary viral structure or stability.

Primers are probably the most critical component of a reliable RT-qPCR assay, as their properties control the exquisite specificity and sensitivity that make this method extraordinarily powerful [19].

This is especially true for single-tube RT-qPCR assays generally used to detect SARS-CoV-2, as viral RNA has a broad secondary structure, which has a substantial impact on reverse transcription efficiency and hence sensitivity. and the reliability of the whole essay [5].

Consequently, poor design combined with failure to optimize reaction conditions is likely to explain false negative results, with variable RNA sequences within the ORF1ab gene and N genes a possible cause of negative or low sensitivity results [23] .

References

1. Mullis K., Faloona F., Saiki R., Horn G., Erlich H., Scharf S. DNA-specific enzymatic amplification in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. To boil. 1986; 51: 263–273. doi: 10.1101 / SQB.1986.051.01.032. [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

2. Bustin S. Absolute quantification of mRNA by real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 2000; 25: 169–193. doi: 10.1677 / jme.0.0250169. [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

3. Myers TW, Gelfand DH Reverse transcription and DNA amplification by Thermus thermophilus DNA polymerase. Biochemistry. 1991; 30: 7661–7666. doi: 10.1021 / bi00245a001. [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

4. Bustin SA AZ of Quantitative PCR. IUL Press; La Jolla, CA, USA: 2004. [  Google Scholar  ]

5. Bustin S., Benes V., Garson JA, Hellemans J., Huggett J., Kubista M., Mueller R., Nolan T., Pfaffl M., Shipley GL, et al. The MIQE guidelines: minimum information for the publication of quantitative real-time PCR experiments. Clin. Chem. 2009; 55: 611–622. doi: 10.1373 / clinchem.2008.112797. [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

6. Hellemans J., Mortier G., De Paepe A., Speleman F., Vandesompele J. qBase relative quantification framework and software for the management and automated analysis of quantitative PCR data in real time. Genome Boil. 2007; 8: R19. doi: 10.1186 / gb-2007-8-2-r19. [  PMC free article  ] [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

7. Sanders R., Bustin S., Huggett J., Mason D. Improving the standardization of mRNA measurement by RT-qPCR. Biomol. Detect. Quantif. 2018; 15: 13-17. doi: 10.1016 / j.bdq.2018.03.001. [  PMC free article  ] [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

8. Sanders R., Huggett JF, Bushell CA, Cowen S., Scott DJ, Foy CA Digital PCR evaluation for absolute DNA quantification. Anal Chem. 2011; 83: 6474–6484. doi: 10.1021 / ac103230c. [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

9. Dong L., Zhou J., Niu C., Wang Q., Pan Y., Sheng S., Wang X., Zhang Y., Yang J., Liu M., et al. Highly accurate and sensitive diagnostic detection of SARS-CoV-2 by digital PCR. medRxiv. Doi 2020: 10.1101 / 2020.03.14. [  CrossRef  ] [  Google Scholar  ]

10. Yu F., Yan L., Wang N., Yang S., Wang L., Tang Y., Gao G., Wang S., Ma C., Xie R., et al. Quantitative detection and analysis of the viral load of SARS-CoV-2 in infected patients. Clin Infect Dis. 2020 doi: 10.1093 / cid / ciaa345. [  PMC free article  ] [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

11. Bustin S. How to accelerate the polymerase chain reaction. Biomol. Detect. Quantif. 2017; 12: 10–14. doi: 10.1016 / j.bdq.2017.05.002. [  PMC free article  ] [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

12. Farrar JS, Wittwer CT Extreme PCR: Efficient and specific DNA amplification in 15–60 seconds. Clin. Chem. 2015; 61: 145–153. doi: 10.1373 / clinchem.2014.228304. [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

13. Notomata T. Loop-mediated isothermal amplification of DNA. Res. Nucleic acids 2000; 28: 63. doi: 10.1093 / nar / 28.12.e63. [  PMC free article  ] [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

14. Lu R., Wu X., Wan Z., Li Y., Zuo L., Qin J., Jin X., Zhang C. Development of a new reverse transcription loop-mediated isothermal amplification method for detection rapid of SARS -CoV-2. Virol. Sin. 2020: 1–4. doi: 10.1007 / s12250-020-00218-1. [  PMC free article  ] [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

15. Belk WP, Sunderman FW A Survey of the Accuracy of Chemical Analysis in Clinical Laboratories. Am. J. Clin. Pathol. 1947; 17 : 853–861. doi: 10.1093 / ajcp / 17.11.853. [ PubMed ] [ CrossRef ] [ Google Scholar ]

16. Lippi G., Simundic AM European Federation for Clinical Chemistry; Laboratory Medicine Working Group (EFLM) for the pre-analytical phase WG-PRE. The EFLM strategy for the harmonization of the pre-analytical phase. Clin. Chem. Laboratory. Med. 2018; 56: 1660–1666. doi: 10.1515 / cclm-2017-0277. [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

17. Bustin SA, Nolan T. Template Manipulation, preparation and quantification. In: Bustin SA, editor. AZ of Quantitative PCR. International University Line; La Jolla, CA, USA: 2004. pp. 143-213. [  Google Scholar  ]

18. Dheda K., Huggett J., Bustin S., Johnson MA, Rook G., Zumla A. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques. 2004; 37 : 112–119. doi: 10.2144 / 04371RR03. [ PubMed ] [ CrossRef ] [ Google Scholar ]

19. Bustin S., Dhillon HS, Kirvell S., Greenwood C., Parker M., Shipley GL, Nolan T. Variability of the Reverse Transcription Step: Practical Implications. Clin. Chem. 2015; 61 : 202–212. doi: 10.1373 / clinchem.2014.230615. [ PubMed ] [ CrossRef ] [ Google Scholar ]

20. Bustin S., Huggett J. qPCR primer design revised. Biomol. Detect. Quantif. 2017; 14: 19–28. doi: 10.1016 / j.bdq.2017.11.001. [  PMC free article  ] [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

21. Corman VM, Landt O., Kaiser M., Molenkamp R., Meijer A., ​​Chu DK, Bleicker T., Brünink S., Schneider J., Schmidt ML, et al. Detection of the new coronavirus of 2019 (2019-nCoV) by real-time RT-PCR. Eurosurveillance. 2020; 25: 2000045. doi: 10.2807 / 1560-7917.ES.2020.25.3.2000045. [  PMC free article  ] [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

22. Chan JF-W., Yip CC-Y., To KK-W., Tang TH-C., Wong SC-Y., Leung K.-H., Fung AY-F., Ng AC-K. , Zou Z., Tsoi H.-W., et al. Improved molecular diagnosis of COVID-19 using the new highly sensitive and specific COVID-19-RdRp / Hel real-time reverse transcription polymerase chain reaction assay validated in vitro and with clinical samples. J. Clin. Microbiol. : 2020. doi: 10.1128 / JCM.00310-20. [  PMC free article  ] [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]

23. Wang Y., Kang H., Liu X., Tong Z.-H. The combination of RT-qPCR testing and clinical features for diagnosing COVID-19 facilitates the management of the SARS-CoV-2 outbreak. J. Med. Virol. 2020; 92: 538–539. doi: 10.1002 / jmv.25721. [  PMC free article  ] [  PubMed  ] [  CrossRef  ] [  Google Scholar  ]


Therefore, the Covid test essentially depends on whether or not the original isolation of the SARS-Cov2 virus has occurred, because the original PCR isolation of the virus is the golden standard necessary to validate subsequent Covid tests.

The problems with the isolation of the original virus, and therefore with the consequent swab test, are many, and all point to the truth that the SARS-Cov2 virus has never been isolated and never tested for its pathogenicity.

As is well known, at the base of microbiology there are the famous Koch’s Postulates, which establish common sense principles of microbiological research: to determine that a microorganism is the cause of a disease, it is necessary to proceed through 4 basic steps:

a) Physically isolate microorganisms, through filtering methods, from a sick patient;

b) Grow the isolated microorganisms in a culture broth;

c) Inject this microorganism broth into a guinea pig, and assess whether the symptoms generated by that injection are similar to the original patient’s symptoms;

d) Isolate the organism again from the newly infected patient and culture it in a culture broth.

These postulates have been applied to live microorganisms such as bacteria, but because they are logical postulates they also apply to non-living “non-organisms” such as viruses, which are non-living particles made up of a strand of RNA (or DNA) covered with an envelope ( capsid) lipoprotein.

Well, even though at least one article has been published stating that Koch’s postulates have been met, the reality is that the SARS-Cov2 virus has never been isolated and tested.

I’ve looked at all the studies that claim to have isolated and even tested the virus, but they all did something very different: They took patients’ pharyngeal or bronchoalveolar fluid, then centrifuged it to separate the larger, heavier molecules from the smaller and lighter molecules, such as the alleged viruses; they then took the supernatant (the top of the centrifuged material) and called that extremely complex matrix ‘”virus isolate” to which they then applied RT-PCR. [Zhu N et al, A Novel Coronavirus from Patients with Pneumonia in China , 2019, N Engl J Med. 2020 Feb 20; 382 (8): 727–733 – https://www.nejm.org/doi/full/10.1056/nejmoa2001017 ]

As per original study:

“ISOLATION OF THE VIRUS

Bronchoalveolar lavage fluid samples were collected in sterile cups to which virus transport medium was added. The samples were then centrifuged to remove cell debris.

The supernatant was inoculated on human airway epithelial cells, Jonsdottir HR , Dijkman R. Coronaviruses and the human airway: a universal system for virus-host interaction studies. Virol J 2016; 13: 24-24.] That were obtained from resected airway specimens from patients undergoing lung cancer surgery and were confirmed free of special pathogens by NGS. [Palacios G, Druce J, Du L, et al. A new arenavirus in a cluster of fatal transplant-associated diseases. N Engl J Med 2008; 358: 991-998.]

Human airway epithelial cells were expanded on plastic substrate to generate step 1 cells and subsequently plated at a density of 2.5 × 10 5 cells per well on Transwell-COL permeable media (12 mm diameter). Human airway epithelial cell cultures were generated at an air-liquid interface for 4-6 weeks to form well-differentiated and polarized cultures similar to pseudostratified mucociliary epithelium in vivo. [Jonsdottir HR, Dijkman R. Coronaviruses and the human airway: a universal system for virus-host interaction studies. Virol J 2016; 13: 24-24.]

Prior to infection, the apical surfaces of human airway epithelial cells were washed three times with phosphate buffered saline; 150 μl of supernatant from bronchoalveolar lavage fluid specimens were inoculated on the apical surface of cell cultures.

After a 2 hour incubation at 37 ° C, the unbound virus was removed by washing with 500 μl of phosphate buffered saline for 10 minutes; human airway epithelial cells were maintained in an air-liquid interface incubated at 37 ° C with 5% carbon dioxide.

Every 48 hours, 150 μl of phosphate buffered saline was applied to the apical surfaces of human airway epithelial cells and after 10 minutes of incubation at 37 ° C the samples were collected. The cells of the pseudostratified mucociliary epithelium were maintained in this environment; apical samples were passed in a 1: 3 diluted vial broth to new cells. The cells were monitored daily with optical microscopy, for cytopathic effects, and with RT-PCR, for the presence of viral nucleic acid in the supernatant. After three passes, apical samples and human airway epithelial cells were prepared for transmission electron microscopy. “

And so as not to get bored … … we report what was done to sequence the so-called “viral genome” … of the alleged COVID-19 …

“SEQUENCING OF THE VIRAL GENOME

RNA extracted from bronchoalveolar lavage fluid and culture supernatants was used as a template to clone and sequence the genome.

We used a combination of Illumina sequencing and nanopore sequencing to characterize the virus genome. Sequence reads were assembled into contig maps (a set of overlapping DNA segments) with the use of CLC Genomics software, version 4.6.1 (CLC Bio).

Subsequently specific primers were designed for PCR and 5′- or 3′-RACE (rapid amplification of the ends of the cDNA) was used to fill the genomic gaps from conventional Sanger sequencing.

These PCR products were purified from gels and sequenced with a BigDye Terminator v3.1 Cycle Sequencing Kit and 3130XL Genetic Analyzer, in accordance with manufacturers’ instructions. “

Alignment of multiple 2019-nCoV sequences and reference sequences was performed with the use of Muscle. Phylogenetic analysis of complete genomes was performed with RAxML (13) with 1000 bootstrap replicates and a time-reversible general model used as a nucleotide substitution model.

It’s a rather technical thing, but I’ll try to simplify: the supernatant contains different types of molecules, billions of different micro and nano particles, including what are called extracellular vesicles (EVs) and exosomes, useful particles produced by our body and absolutely indistinguishable from virus:

“Nowadays, it is a nearly impossible mission to separate extracellular vesicles and viruses through canonical methods of vesicle isolation, such as differential ultra-centrifugation, because they are often co-pelleted (collected together) due to their similar size. . ” [Giannessi F. et al., The Role of Extracellular Vesicles as Allies of HIV, HCV and SARS Viruses, Viruses 2020, 12, 571; doi: 10.3390 / v12050571, p.4.]

Scientifically translated … ..

Extracellular vesicles (EVs) and viruses: close relatives?

In recent decades, the similarity between extracellular vesicles (EVs) and viral particles has become increasingly evident.

 Viruses and extracellular vesicles (EVs) share several aspects such as size, structural and biochemical composition, and the transport of bioactive molecules within cells [34, 35].

Like extracellular vesicles (EVs), viruses range in size from 30 to 1000 nm, starting with small ones, such as poliovirus and hepatitis A virus (HAV) particles, which have a diameter of about 30 nm , up to hepatitis C virus (HCV) of about 50 nm and HIV or SARS virus of about 100-120 nm.

Finally, mimiviruses have a size of about 400 nm. Furthermore, EVs and some viruses have morphological similarities: as described above, EVs are double-membrane enclosed entities, and enveloped viruses are also surrounded by a lipid membrane acquired by the cell.

Interestingly, they possess a similar lipid composition enriched in glycosphingolipids and cholesterol, as well as a similar protein content.

In particular, both extracellular vesicles (EVs) and viruses carry nucleic acids; while viruses have single or double stranded RNA or DNA genomes, 35, 37, 38]. EVs and enveloped viruses also share similar biogenesis processes as both are generated in the endosomal network or germinate from the plasma membrane using specific pathways [18].

For example, some retroviruses such as HIV hijack cellular vesiculation mechanisms to promote their own replication and budding. In this regard, it has been reported that the endosomal sorting complex (ESCRT), the same that mediates inward invasion of ILVs in MVBs, is also involved in the budding and release of HIV particles [39, 40] .

Furthermore, just as extracellular vesicles (EVs) can be generated from pathways independent of ESCRT, some viruses germinate from specific membrane domains [41].

These domains, called lipid rafts, are enriched in glycosphingolipids, cholesterol and ceramide. Furthermore, proteins such as tetraspanins are stored in these domains and form clusters with each other and other transmembrane and cytosolic proteins, thus inducing inward sprouting of the microdomains in which they are enriched [42].

As mentioned above, specific glycocalyx compositions also play a role in vesicle release; however, the glycocalyx may also be involved in other membrane processes, including the uptake of some viruses [43].

In this regard, some viruses have evolved to exploit specific glycans to enter cells, such as human rotaviruses that bind blood group A antigens [44].

 Instead, in the case of HIV [45], Ebola virus [46], HCV [47], as well as influenza [48] or severe acute respiratory syndrome (SARS) [49] viruses, the viruses themselves have glycans on their surface. Their presence on viral surfaces is exploited by immune cells, such as macrophages or dendritic cells, for phagocyte virions.

In turn, the Ebola viruses [46] and SARS [49] exploit this antiviral system to enter and replicate in macrophages and dendritic cells. On the other hand, glycans are also used by viruses to create a shield that hides viral epitopes from immune cells, as is the case with HIV, which is known to have the highest density of glycans attached to its surface proteins [50 ] and the Lassa virus [51].

The substantial overlap of biogenesis processes provides a plausible explanation for the similar composition observed between IV and enveloped viruses [39].

Furthermore, both IVs and enveloped viruses can bind to the plasma membrane of recipient cells and, after fusion events, directly with the surface membrane or after endocytosis, release their luminal load into the cytosol, affecting cell activity. [18].

 In this regard, similar to viral envelope proteins, EV surface proteins, such as intercellular adhesion molecule 1 (ICAM-1), mediate adhesion and internalization of EVs in target cells. [52].

Therefore, both extracellular vesicles (EVs) and viruses can be considered bioactive structures capable of influencing cellular behavior.

The presence of multiple similarities between viruses (in particular retroviruses) and EVs immediately triggered speculations about the real relationship between vesicles and viruses.

For this reason, two alternative theories have been proposed. The first, called the “Trojan exosome hypothesis,” states that retroviruses are evolved vesicles as a result of a mutation in the gag gene, originally encoded by an integrated retro-transposon that directed its expression product towards the vesicle generation pathway.

In this perspective, the typical characteristics of retroviruses would have been acquired by the evolutionary divergence; the pre-existing biogenesis mechanism of vesicle production would have been used to form viral particles [53].

The second theory does not associate viruses with modified exosomes. It justifies the similarities, giving greater importance to the phenomenon of convergent evolution, which would lead to the sharing of the same pathways of biogenesis for vesicles and viruses [54].

 Both theories provide a plausible justification for the observed affinities between virus and EV.

However, regardless of their possible origin, these affinities certainly have a negative impact on immunological surveillance in the host, as viruses, during infections, can take advantage of these affinities to escape the immune system by mimicking the composition and behavior of the vesicles [ 55].

The remarkable similarity between extracellular vesicles (EV) and viruses has caused several problems in studies focused on the analysis of extracellular vesicles (EV) released during viral infections.

Nowadays, it is a near-impossible mission to separate EVs and viruses using canonical methods of vesicle isolation, such as differential ultracentrifugation, because they are often co-pelleted due to their similar size [56, 57].

To overcome this problem, several studies have proposed the separation of EVs from viral particles by exploiting their different migration rates in a density gradient or by using the presence of specific markers that distinguish viruses from EVs [56, 58, 59].

However, to date, there is no reliable method that can actually guarantee complete separation.

*[reference link : The Role of Extracellular Vesicles as Allies of HIV, HCV and SARS Viruses – https://www.mdpi.com/1999-4915/12/5/571/htm

18.     Colombo, M.; Raposo, G.; Théry, C. Biogenesis, secretion, and intercellular interactions of exosomes and other extracellular vesicles. Annu. Rev. Cell Dev. Biol. 2014, 30, 255–289.  [Google Scholar] [CrossRef]

  • 34 Schorey, J.S.; Cheng, Y.; Singh, P.P.; Smith, V.L. Exosomes and other extracellular vesicles in host–pathogen interactions. EMBO Rep. 201516, 24–43. [Google Scholar] [CrossRef] [PubMed]
  • 35 Valadi, H.; Ekström, K.; Bossios, A.; Sjöstrand, M.; Lee, J.J.; Lötvall, J.O. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat. Cell Biol. 20079, 654–659. [Google Scholar] [CrossRef]
  • 36 Aiello, A.; Giannessi, F.; Percario, Z.A.; Affabris, E. An emerging interplay between extracellular vesicles and cytokines. Cytokine Growth Factor Rev. 202051, 49–60. [Google Scholar] [CrossRef]
  • 37 Nolte-’t Hoen, E.N.M.; Buermans, H.P.J.; Waasdorp, M.; Stoorvogel, W.; Wauben, M.H.M.; ’t Hoen, P.A.C. Deep sequencing of RNA from immune cell-derived vesicles uncovers the selective incorporation of small non-coding RNA biotypes with potential regulatory functions. Nucleic Acids Res. 201240, 9272–9285. [Google Scholar] [CrossRef]
  • 38 Vojtech, L.; Woo, S.; Hughes, S.; Levy, C.; Ballweber, L.; Sauteraud, R.P.; Strobl, J.; Westerberg, K.; Gottardo, R.; Tewari, M.; et al. Exosomes in human semen carry a distinctive repertoire of small non-coding RNAs with potential regulatory functions. Nucleic Acids Res. 201442, 7290–7304. [Google Scholar] [CrossRef]
  • 39 Morita, E.; Sundquist, W.I. Retrovirus budding. Annu. Rev. Cell Dev. Biol. 200420, 395–425. [Google Scholar] [CrossRef]
  • 40 Bieniasz, P.D. Late budding domains and host proteins in enveloped virus release. Virology 2006344, 55–63. [Google Scholar] [CrossRef]
  • 41 Nguyen, D.H.; Hildreth, J.E. Evidence for budding of human immunodeficiency virus type 1 selectively from glycolipid-enriched membrane lipid rafts. J. Virol. 200074, 3264–3272. [Google Scholar] [CrossRef] [PubMed]
  • 42 Trajkovic, K.; Hsu, C.; Chiantia, S.; Rajendran, L.; Wenzel, D.; Wieland, F.; Schwille, P.; Brügger, B.; Simons, M. Ceramide triggers budding of exosome vesicles into multivesicular endosomes. Science 2008319, 1244–1247. [Google Scholar] [CrossRef] [PubMed]
  • 43 Le Mercier, P.; Mariethoz, J.; Lascano-Maillard, J.; Bonnardel, F.; Imberty, A.; Ricard-Blum, S.; Lisacek, F. A Bioinformatics View of Glycan-Virus Interactions. Viruses 201911, 374. [Google Scholar] [CrossRef] [PubMed]
  • 44 Böhm, R.; Fleming, F.E.; Maggioni, A.; Dang, V.T.; Holloway, G.; Coulson, B.S.; von Itzstein, M.; Haselhorst, T. Revisiting the role of histo-blood group antigens in rotavirus host-cell invasion. Nat. Commun. 20156, 5907. [Google Scholar] [CrossRef] [PubMed]
  • 45 da Silva, R.C.; Segat, L.; Crovella, S. Role of DC-SIGN and L-SIGN receptors in HIV-1 vertical transmission. Hum. Immunol. 201172, 305–311. [Google Scholar] [CrossRef] [PubMed]
  • 46 Simmons, G.; Reeves, J.D.; Grogan, C.C.; Vandenberghe, L.H.; Baribaud, F.; Whitbeck, J.C.; Burke, E.; Buchmeier, M.J.; Soilleux, E.J.; Riley, J.L.; et al. DC-SIGN and DC-SIGNR bind ebola glycoproteins and enhance infection of macrophages and endothelial cells. Virology 2003305, 115–123. [Google Scholar] [CrossRef]
  • 47 Lai, W.K.; Sun, P.J.; Zhang, J.; Jennings, A.; Lalor, P.F.; Hubscher, S.; McKeating, J.A.; Adams, D.H. Expression of DC-SIGN and DC-SIGNR on Human Sinusoidal Endothelium. Am. J. Pathol. 2006169, 200–208. [Google Scholar] [CrossRef]
  • 48 Londrigan, S.L.; Turville, S.G.; Tate, M.D.; Deng, Y.-M.; Brooks, A.G.; Reading, P.C. N-linked glycosylation facilitates sialic acid-independent attachment and entry of influenza A viruses into cells expressing DC-SIGN or L-SIGN. J. Virol. 201185, 2990–3000. [Google Scholar] [CrossRef]
  • 49 Yang, Z.-Y.; Huang, Y.; Ganesh, L.; Leung, K.; Kong, W.-P.; Schwartz, O.; Subbarao, K.; Nabel, G.J. pH-dependent entry of severe acute respiratory syndrome coronavirus is mediated by the spike glycoprotein and enhanced by dendritic cell transfer through DC-SIGN. J. Virol. 200478, 5642–5650. [Google Scholar] [CrossRef]
  • 50 Bonomelli, C.; Doores, K.J.; Dunlop, D.C.; Thaney, V.; Dwek, R.A.; Burton, D.R.; Crispin, M.; Scanlan, C.N. The glycan shield of HIV is predominantly oligomannose independently of production system or viral clade. PLoS ONE 20116, e23521. [Google Scholar] [CrossRef]
  • 51 Watanabe, Y.; Raghwani, J.; Allen, J.D.; Seabright, G.E.; Li, S.; Moser, F.; Huiskonen, J.T.; Strecker, T.; Bowden, T.A.; Crispin, M. Structure of the Lassa virus glycan shield provides a model for immunological resistance. Proc. Natl. Acad. Sci. USA 2018115, 7320–7325. [Google Scholar] [CrossRef]
  • 52 Segura, E.; Nicco, C.; Lombard, B.; Véron, P.; Raposo, G.; Batteux, F.; Amigorena, S.; Théry, C. ICAM-1 on exosomes from mature dendritic cells is critical for efficient naive T-cell priming. Blood 2005106, 216–223. [Google Scholar] [CrossRef] [PubMed]
  • 53 Gould, S.J.; Booth, A.M.; Hildreth, J.E.K. The Trojan exosome hypothesis. Proc. Natl. Acad. Sci. USA 2003100, 10592–10597. [Google Scholar] [CrossRef] [PubMed]
  • 54 Pelchen-Matthews, A.; Raposo, G.; Marsh, M. Endosomes, exosomes and Trojan viruses. Trends Microbiol. 200412, 310–316. [Google Scholar] [CrossRef] [PubMed]
  • 55 Izquierdo-Useros, N.; Puertas, M.C.; Borràs, F.E.; Blanco, J.; Martinez-Picado, J. Exosomes and retroviruses: The chicken or the egg? Cell. Microbiol. 201113, 10–17. [Google Scholar] [CrossRef] [PubMed]
  • 56 Eckner, R.J.; Hettrick, K.L. Defective Friend Spleen Focus-Forming Virus: Interfering Properties and Isolation Free from Standard Leukemia-Inducing Helper Virus. J. Virol. 197724, 383–396. [Google Scholar] [CrossRef] [PubMed]
  • 57 Théry, C.; Witwer, K.W.; Aikawa, E.; Alcaraz, M.J.; Anderson, J.D.; Andriantsitohaina, R.; Antoniou, A.; Arab, T.; Archer, F.; Atkin-Smith, G.K.; et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): A position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J. Extracell. Vesicles 20187, 1535750. [Google Scholar] [CrossRef]
  • 58 Cantin, R.; Diou, J.; Bélanger, D.; Tremblay, A.M.; Gilbert, C. Discrimination between exosomes and HIV-1: Purification of both vesicles from cell-free supernatants. J. Immunol. Methods 2008338, 21–30. [Google Scholar] [CrossRef]
  • 59 Konadu, K.A.; Huang, M.B.; Roth, W.; Armstrong, W.; Powell, M.; Villinger, F.; Bond, V. Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals. J. Vis. Exp. 2016107, e53495. [Google Scholar] [CrossRef]

If what you have read so far seems shocking … then I ask you to sit down if you are not already …

Being a very curious person, I started researching the genomic sequence used by the WHO to identify COVID-19 in PCR tests on institutional sites.

The main document I started from was this: Protocol: Real-time RT-PCR assays for the detection of SARS-CoV-2 Institut Pasteur, Paris, officially traceable on the WHO website at https: //www.who. int / docs / default-source / coronaviruse / real-time-rt-pcr-assays-for-the-detection-of-sars-cov-2-institut-pasteur-paris.pdf? sfvrsn = 3662fcb6_2 .

I therefore report what is officially quoted:

“This protocol describes the procedures for detecting SARS-CoV-2 for two RdRp targets (IP2 and IP4).

Based on the first SARS-CoV-2 sequences made available on the GISAID database on January 11, 2020, primers and probes (nCoV_IP2 and nCoV_IP4) were designed to target the RdRp gene spanning between nt 12621-12727 and 14010-14116 (positions according to SARS-CoV, NC_004718).

As a confirmatory test, we used the E gene test from the Charité 1 protocol

Material

Kit:

NucleoSpin Dx Virus Extraction Kit Ref: Macherey Nagel 740895.50 SuperScript ™ III Platinum® Quantitative One Step RT-PCR System Ref: Invitrogen 1732-020

Primers and probes

First nameSequences (5′-3 ‘)Length (bases)PCR product sizeRef.
Gene RdRp / nCoV_IP2
nCoV_IP2-12669FwATGAGCTTAGTCCTGTTG17  108 bp  1
nCoV_IP2-12759RvCTCCCTTTGTTGTGTTGT18
nCoV_IP2-12696bProbe (+)AGATGTCTTGTGCTGCCGGTA [5 ‘] Hex [3’] BHQ-121
Gene RdRp / nCoV_IP4
nCoV_IP4-14059FwGGTAACTGGTATGATTTCG19  107 bp  1
nCoV_IP4-14146RvCTGGTCAAGGTTAATATAGG20
nCoV_IP4-14084Probe (+)TCATACAAACCACGCCAGG [5 ‘] Fam [3’] BHQ-119
And gene / E_Sarbeco
E_Sarbeco_F1ACAGGTACGTTAATAGTTAATAGCGT18  125 bp  2
E_Sarbeco_R2ATATTGCAGCAGTACGCACACA20
E_Sarbeco_P1ACACTAGCCATCCTTACTGCGCTTCG [5 ‘] Fam [3’] BHQ-120

1 / National reference center for respiratory viruses, Institut Pasteur, Paris. 2 / Corman et al. Eurosurveillance 1

……

I immediately started a search in the NCBI database for nucleotide sequences, and this led me to a surprising discovery.

One of the WHO primer sequences in the PCR test for SARS-CoV-2 is found in all human DNA!

The “CTCCCTTTGTTGTGTTGT” sequence is an 18-character primer sequence found in the WHO Coronavirus PCR Test Protocol document.

The primer sequences are what is amplified by the PCR process to be detected and designated as a “positive” test result.

So it happens that this identical sequence of 18 characters, literally, is also found on chromosome 8 of Homo sapiens!

Homo sapiens chromosome 8, GRCh38.p12 Primary Assembly
Sequence ID: NC_000008.11 Length: 145138636
Range 1: 63648346 to 63648363 is “CTCCCTTTGTTGTGTTGT”

Don’t believe it … ..

Homo sapiens chromosome 8, GRCh38.p13 Primary Assembly

NCBI Reference Sequence: NC_000008.11

FASTA  Graphics

Go to:

LOCUS       NC_000008                 18 bp    DNA     linear   CON 17-AUG-2020
DEFINITION  Homo sapiens chromosome 8, GRCh38.p13 Primary Assembly.
ACCESSION   NC_000008 REGION: 63648346..63648363
VERSION     NC_000008.11
DBLINK      BioProject: PRJNA168
Assembly: GCF_000001405.39
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 18)
  AUTHORS   Nusbaum,C., Mikkelsen,T.S., Zody,M.C., Asakawa,S., Taudien,S.,
            Garber,M., Kodira,C.D., Schueler,M.G., Shimizu,A., Whittaker,C.A.,
            Chang,J.L., Cuomo,C.A., Dewar,K., FitzGerald,M.G., Yang,X.,
            Allen,N.R., Anderson,S., Asakawa,T., Blechschmidt,K., Bloom,T.,
            Borowsky,M.L., Butler,J., Cook,A., Corum,B., DeArellano,K.,
            DeCaprio,D., Dooley,K.T., Dorris,L. III, Engels,R., Glockner,G.,
            Hafez,N., Hagopian,D.S., Hall,J.L., Ishikawa,S.K., Jaffe,D.B.,
            Kamat,A., Kudoh,J., Lehmann,R., Lokitsang,T., Macdonald,P.,
            Major,J.E., Matthews,C.D., Mauceli,E., Menzel,U., Mihalev,A.H.,
            Minoshima,S., Murayama,Y., Naylor,J.W., Nicol,R., Nguyen,C.,
            O'Leary,S.B., O'Neill,K., Parker,S.C., Polley,A., Raymond,C.K.,
            Reichwald,K., Rodriguez,J., Sasaki,T., Schilhabel,M., Siddiqui,R.,
            Smith,C.L., Sneddon,T.P., Talamas,J.A., Tenzin,P., Topham,K.,
            Venkataraman,V., Wen,G., Yamazaki,S., Young,S.K., Zeng,Q.,
            Zimmer,A.R., Rosenthal,A., Birren,B.W., Platzer,M., Shimizu,N. and
            Lander,E.S.
  TITLE     DNA sequence and analysis of human chromosome 8
  JOURNAL   Nature 439 (7074), 331-335 (2006)
   PUBMED   16421571
  REFERENCE   2  (bases 1 to 18)
  CONSRTM   International Human Genome Sequencing Consortium
  TITLE     Finishing the euchromatic sequence of the human genome
  JOURNAL   Nature 431 (7011), 931-945 (2004)
  PUBMED   15496913

REFERENCE   3  (bases 1 to 18)
  AUTHORS   Lander,E.S., Linton,L.M., Birren,B., Nusbaum,C., Zody,M.C.,
            Baldwin,J., Devon,K., Dewar,K., Doyle,M., FitzHugh,W., Funke,R.,
            Gage,D., Harris,K., Heaford,A., Howland,J., Kann,L., Lehoczky,J.,
            LeVine,R., McEwan,P., McKernan,K., Meldrim,J., Mesirov,J.P.,
            Miranda,C., Morris,W., Naylor,J., Raymond,C., Rosetti,M.,
            Santos,R., Sheridan,A., Sougnez,C., Stange-Thomann,N.,
            Stojanovic,N., Subramanian,A., Wyman,D., Rogers,J., Sulston,J.,
            Ainscough,R., Beck,S., Bentley,D., Burton,J., Clee,C., Carter,N.,
            Coulson,A., Deadman,R., Deloukas,P., Dunham,A., Dunham,I.,
            Durbin,R., French,L., Grafham,D., Gregory,S., Hubbard,T.,
            Humphray,S., Hunt,A., Jones,M., Lloyd,C., McMurray,A., Matthews,L.,
            Mercer,S., Milne,S., Mullikin,J.C., Mungall,A., Plumb,R., Ross,M.,
            Shownkeen,R., Sims,S., Waterston,R.H., Wilson,R.K., Hillier,L.W.,
            McPherson,J.D., Marra,M.A., Mardis,E.R., Fulton,L.A.,
            Chinwalla,A.T., Pepin,K.H., Gish,W.R., Chissoe,S.L., Wendl,M.C.,
            Delehaunty,K.D., Miner,T.L., Delehaunty,A., Kramer,J.B., Cook,L.L.,
            Fulton,R.S., Johnson,D.L., Minx,P.J., Clifton,S.W., Hawkins,T.,
            Branscomb,E., Predki,P., Richardson,P., Wenning,S., Slezak,T.,
            Doggett,N., Cheng,J.F., Olsen,A., Lucas,S., Elkin,C.,
            Uberbacher,E., Frazier,M., Gibbs,R.A., Muzny,D.M., Scherer,S.E.,
            Bouck,J.B., Sodergren,E.J., Worley,K.C., Rives,C.M., Gorrell,J.H.,
            Metzker,M.L., Naylor,S.L., Kucherlapati,R.S., Nelson,D.L.,
            Weinstock,G.M., Sakaki,Y., Fujiyama,A., Hattori,M., Yada,T.,
            Toyoda,A., Itoh,T., Kawagoe,C., Watanabe,H., Totoki,Y., Taylor,T.,
            Weissenbach,J., Heilig,R., Saurin,W., Artiguenave,F., Brottier,P.,
            Bruls,T., Pelletier,E., Robert,C., Wincker,P., Smith,D.R.,
            Doucette-Stamm,L., Rubenfield,M., Weinstock,K., Lee,H.M.,
            Dubois,J., Rosenthal,A., Platzer,M., Nyakatura,G., Taudien,S.,
            Rump,A., Yang,H., Yu,J., Wang,J., Huang,G., Gu,J., Hood,L.,
            Rowen,L., Madan,A., Qin,S., Davis,R.W., Federspiel,N.A.,
            Abola,A.P., Proctor,M.J., Myers,R.M., Schmutz,J., Dickson,M.,
           Grimwood,J., Cox,D.R., Olson,M.V., Kaul,R., Raymond,C., Shimizu,N.,
            Kawasaki,K., Minoshima,S., Evans,G.A., Athanasiou,M., Schultz,R.,
            Roe,B.A., Chen,F., Pan,H., Ramser,J., Lehrach,H., Reinhardt,R.,
            McCombie,W.R., de la Bastide,M., Dedhia,N., Blocker,H.,
            Hornischer,K., Nordsiek,G., Agarwala,R., Aravind,L., Bailey,J.A.,
            Bateman,A., Batzoglou,S., Birney,E., Bork,P., Brown,D.G.,
            Burge,C.B., Cerutti,L., Chen,H.C., Church,D., Clamp,M.,
            Copley,R.R., Doerks,T., Eddy,S.R., Eichler,E.E., Furey,T.S.,
            Galagan,J., Gilbert,J.G., Harmon,C., Hayashizaki,Y., Haussler,D.,
            Hermjakob,H., Hokamp,K., Jang,W., Johnson,L.S., Jones,T.A.,
            Kasif,S., Kaspryzk,A., Kennedy,S., Kent,W.J., Kitts,P.,
            Koonin,E.V., Korf,I., Kulp,D., Lancet,D., Lowe,T.M., McLysaght,A.,
            Mikkelsen,T., Moran,J.V., Mulder,N., Pollara,V.J., Ponting,C.P.,
            Schuler,G., Schultz,J., Slater,G., Smit,A.F., Stupka,E.,
            Szustakowski,J., Thierry-Mieg,D., Thierry-Mieg,J., Wagner,L.,
            Wallis,J., Wheeler,R., Williams,A., Wolf,Y.I., Wolfe,K.H.,
            Yang,S.P., Yeh,R.F., Collins,F., Guyer,M.S., Peterson,J.,
            Felsenfeld,A., Wetterstrand,K.A., Patrinos,A., Morgan,M.J., de
            Jong,P., Catanese,J.J., Osoegawa,K., Shizuya,H., Choi,S. and
            Chen,Y.J.
  CONSRTM   International Human Genome Sequencing Consortium
  TITLE     Initial sequencing and analysis of the human genome
  JOURNAL   Nature 409 (6822), 860-921 (2001)
   PUBMED   11237011
  REMARK    Erratum:[Nature 2001 Aug 2;412(6846):565]
COMMENT     REFSEQ INFORMATION: The reference sequence is identical to
            CM000670.2.
            On Feb 3, 2014 this sequence version replaced NC_000008.10.
            Assembly Name: GRCh38.p13 Primary Assembly
            The DNA sequence is composed of genomic sequence, primarily
            finished clones that were sequenced as part of the Human Genome
            Project. PCR products and WGS shotgun sequence have been added
            where necessary to fill gaps or correct errors. All such additions
            are manually curated by GRC staff. For more information see:
            https://genomereference.org.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                                      Release 109.20200815            Annotation Version          :: 109.20200815
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..18
                     /organism="Homo sapiens"
                     /mol_type="genomic DNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
ORIGIN    
  
        1 ctccctttgt tgtgttgt
//

Link: https://www.ncbi.nlm.nih.gov/nucleotide/NC_000008.11?report=genbank&log$=nuclalign&from=63648346&to=63648363

As far as I know, this means that WHO test kits should find a positive result in all humans.

Can anyone explain it differently?

We cannot underestimate this discovery and its significance … ..

Anticipating the possible observations … .. of mega professors and researchers … .. who could say …

… The virus is an RNA virus and chromosome 8 is DNA. It will not be replicated by RT-PCR, because this process starts with reverse transcriptase (RT!) And therefore does not copy the DNA.

Reply …. The remaining question is whether this fragment could exist as RNA in human cells, which is still possible… Furthermore, it is also necessary to have the probe in proximity to the primer. If the PCR does not hit the probe, the test will remain negative. Is the probe located on chromosome 8?

Without getting too technical, at a minimum, it should have a major impact on test results.

Let us resume our considerations on the basis of what we know of the scientific world.

So how do you isolate a specific virus from this huge mixture of billions of indistinguishable particles, which includes beneficial exosomes?

Well, it is not done, it is impossible, and therefore the virus is “recreated” through RT-PCR: take two primers, two already existing genetic sequences available in genetic banks, and put them in contact with the supernatant broth, until they anneal to some RNA fragment in the broth, thus creating an artificial DNA molecule, which is then multiplied with a certain number of PCR runs: each run doubles the amount of DNA, so in theory the more runs the greater it is the amount of DNA produced; but the greater the number of runs, the lower the reliability of the PCR, that is its ability to actually “produce” something significant from the supernatant, something that has minimal to do with the virus you are looking for:

All studies, as well as current swab tests, always use between 35 and 40 strokes.

The first unanswered question is: primers consist of 18-24 bases (nucleotides) each; the SARS-Cov2 virus is presumably composed of 30,000 bases; thus the primer represents only 0.07% of the virus genome.

How can you select the specific virus you are looking for based on such a minute primer, and furthermore in a sea of ​​billions of virus-like particles?

 It would be like looking for an elephant using very small gray hairs on the tail: looking with such gray hairs you can find gray cats, gray dogs, graying humans and so on.

But there is more.

Since the virus you are looking for is new, there are clearly no ready-made genetic primers to match the specific fraction of the new virus; then you take primers that are thought to resemble the hypothesized virus structure, but it is a mere guess, and when you apply the primers to the supernatant broth, they can attach to any of the billions of molecules present, and there is no certainty that what you have thus generated is the virus you are looking for.

It is, in fact, a new artificial creation created by researchers, which is then called the “SARS-Cov2 virus”, but there is no connection with the alleged virus responsible for the disease.

The standard RT-PCR methodology is plagued by fundamental problems, and this is the reason why they are now trying to develop a new technology, called NGS (new generation sequencing), which is also full of limitations. the most honest researchers aware:

“The most commonly used PCR-based methodologies require knowledge of the genomic sequences of the microorganism; however, this knowledge is not always available. A typical case is represented by outbreaks of emerging pathogens …

Because random / unbiased amplification amplifies host nucleic acids along with microbial ones, looking for microbial nucleic acids is like looking for a needle in a haystack. “

And this, which corresponds to what has been said so far, concerns both RT-PCR and NSG.

This is also because many studies have shown that up to 95% of the virus-like particles present in the patient’s body belong to the patient’s own genome:

“The identification of pathogen nucleic acids in clinical samples is complicated by the presence of the usual preponderant host background … In the study by Brown and colleagues, it was possible not to assign only 0.4% of the total readings to the human genome .” [Calistri A. Palù G., Unbiased Next-Generation Sequencing and New Pathogen Discovery: Undeniable Advantages and Still-Existing Drawbacks, Clinical Infectious Diseases, 2015; 60 (6): 889–91, p. 889.]

This confirms the thesis that the patient’s pharyngeal or bronchoalveolar fluid is like a sea of ​​billions of viral-like particles, and most of which, such as extracellular vesicles and exosomes, belong to the patient’s genome.

And that raises the next question:

If you have no idea what the virus is, how it is made, how can you say it is responsible for anything?

However, Chinese researchers also tried to prove the pathogenicity of the virus.

In a specific Chinese study [Bao L. Et al. The Pathogenicity of SARS-CoV-2 in hACE2 Transgenic Mice, Nature (2020) 10.1038 / s41586-020-2312-y.], Took the pharyngeal fluid supernatant (passing it off as an isolated virus), and injected it into mice , comparing it to a placebo.

Now, even if it has not been isolated, if there was indeed a virus responsible for the disease, it would still be present in significant quantities in the supernatant of the patient’s pathological fluid.

Therefore, once injected into guinea pigs it should still produce devastating effects on animals.

But the worst effect it produced was some “bristling hair” and a minimal weight reduction of 8, but even these minimal effects were only achieved on genetically engineered mice, while there was absolutely no effect. on natural, non-genetically modified or “wild” (WT) mice.

As reported in the study:

“Male and female mice free from specific pathogens (n ​​= 15) or hACE2 (n = 19) aged 6 to 11 months were intranasally inoculated with SARS-CoV-2 strain HB-01 at a dose of 10  5  50% infectious tissue culture dose (TCID  50  ) per 50 μL inoculum volume per mouse, after the mice were anesthetized intraperitoneally using 2.5% avertin; sham-treated hACE2 mice (n = 15) were used as controls.

 Clinical manifestations were recorded from 13 mice (3 wild-type mice infected with HB-01; 3 sham-treated hACE2 mice; and 7 hACE2 mice infected with HB-01). 

We observed light hair and weight loss only in hACE2 mice infected with HB-01 – and not in wild-type mice infected with HB-01 or sham-treated hACE2 mice – during the 14 days of observation; other clinical symptoms, such as an arched back and reduced response to external stimuli, were not found in any of the mice. 

Notably, weight loss of HB-01 infected hACE2 mice was up to 8% 5 days post infection (dpi) (Fig.  1a  ).

Fig. 1: Weight loss, virus replication and specific IgG production in hACE2 mice after SARS-CoV-2 infection.

a  , Weight loss was recorded for 14 days. HACE2 mice (n = 7) and wild-type (WT) mice (n = 3) were experimentally challenged intranasally with SARS-CoV-2 HB-01 and hACE2 (ACE2 + mock) mice treated with mock (n = 3) were used as a control. According to the two-tailed Mann-Whitney U test, the weight of hACE2 mice infected with HB-01 (ACE2 + HB-01) showed a significant decrease compared to that of wild-type mice infected with HB-01 (WT + HB-01) -01) or hACE2 mice treated with mock (*** P = 0.0005). 
bTo measure viral RNA, 12 mice were infected in each group. Three mice per group were killed and their major organs (including the testis in male mice) were collected for viral load and virus titer analysis at 1, 3, 5 and 7 dpi. The distribution of SARS-CoV-2 in the primary organs of hACE2 mice infected with HB-01 was detected using RT-qPCR. 
c , lung virus titers were determined on Vero E6 cells. According to a two-tailed unmated Welch t test, viral titers in the lungs of HB-01 infected hACE2 mice (n = 3) showed a significant increase over those of HB-01 infected wild-type mice (n = 3) or sham-treated hACE2 mice (n = 3) at 1 (** P = 0.0053), 3 (** P = 0.0022) and 5 (** P = 0.0081) dpi. d  , Virus isolated from the lungs of hACE2 mice infected with HB-01 at 3 dpi was observed by electron microscopy. Scale bar, 200 nm. The data are representative of three independent experiments. e , Specific IgG against SARS-CoV-2 was detected from sera from mice (wild-type (n = 3) or hACE2 (n = 7) mice infected with HB-01) at day 0 and 21 dpi by enzyme- linked immunosorbent assay (ELISA). OD  450  , optical density at 450 nm. Two-tailed unpaired Student’s t-test; not significant (NS), P = 0.2193; Unpaired two-tailed Welch t-test, *** P = 3.11 × 10 −6  . The data in  a  –  c  ,  e  are mean ± sd

I would like to …. Point out that the whole study is based on MICE… .. not human beings…. Moreover modified…. appropriately for the experiment … as reported in the study:

“Mouse experiments

For experiments in mice, male and female mice aged 6 to 11 months, free of specific pathogens, were obtained from the Institute of Laboratory Animal Science, Peking Union Medical College.

Transgenic mice were generated by microinjection of the mouse Ace2 promoter driving the human ACE2 coding sequence into the pronuclei of fertilized ova from ICR mice, and then integrated human ACE2 was identified by PCR as previously described 10; human ACE2 expressed primarily in the lungs, heart, kidneys and intestines of transgenic mice.

After being intraperitoneally anesthetized with 2.5% avertine with 0.02 ml / g body weight, hACE2 or wild-type (ICR) mice were intranasally inoculated with SARS-CoV- stock virus. 2 at a dose of 10 5 TCID50 and hACE2 mice inoculated intranasally with an equal volume of PBS were used as a sham infection control.

 Infected mice were continuously observed to record body weight, clinical symptoms, responses to external stimuli, and death. Mice were dissected at 1, 3, 5 and 7 dpi to harvest different tissues for screening for virus replication and histopathological changes.

Laboratory preparation of the SARS-CoV-2 S1 protein antibody

Mice were immunized with purified SARS-CoV-2 S1 protein (Sino biological) and splenocytes from hyperimmunized mice were fused with myeloma cells. Positive clones were selected by ELISA using the SARS-CoV-2 S1 protein ( Extended data Fig. 5 ). The cellular supernatant of clone 7D2, which binds to the SARS-CoV-2 S1 protein, was collected for immunofluorescence analysis. “

Extended data Fig. 5: Identification of the 7D2 antibody against the SARS-CoV-2 S1 protein.




The plate coated with 0.2 μg SARS-CoV-2 S1 protein was incubated with 7D2 antibody as the primary antibody (1: 200) and detected using HRP-conjugated goat anti-mouse secondary antibody. The antibody titer was determined using ELISA. Data are mean ± sd Significant differences are indicated with asterisks (n = 3, unpaired two-tailed Student’s t-test, ** P = 0.0011).

This means that the virus is unable to do the slightest damage to normal mice, and therefore…. ” presumably ”on normal human individuals .

The mice were genetically engineered to over-produce the special ACE2 enzyme, the overproduction of which could explain some of the mild symptoms found in the genetically engineered mice. [Just to give an example, the ACE2 enzyme breaks down, or breaks down, the hormone ghrelin, responsible for stimulating hunger, so the over-production of ACE2 can decrease hunger and contribute to weight loss. Unger T, Ulrike M, Steckelings UM, dos Santos RA (eds.). The protective arm of the Renin Angiotensin System (RAS): functional aspects and therapeutic implications, Academic Press. pp. 185–189.]

What is certain is that no effect whatsoever was produced by the so-called virus on mice.

And this is the most important study that demonstrates the pathogenicity of the Covid-19 virus, the article par excellence published in the most important scientific journal, Nature!

As this virus has never really been isolated, and therefore there is no gold standard to support further studies or tests, no standard to guide them, anyone is free to build their own private SARS-Cov2 virus!

This is why there are now, in GISAID genome bank, the organization that collects and stores all genomic sequences, over 70,000 gene sequences of the SARS-Cov2 virus, each claiming to be the real one.

To accommodate this madness, they now tell us that the virus mutates, which is why there are so many different sequences. But is it credible that 70,000 different gene structures all correspond to the same virus?

It would be as if you had a John, of which there are 70,000 different images, in each of which he looks like a man, then a woman, then a dog, then a snake, and so on, and yet you would like to convince me that they are all and always John!

This, among other things, raises a further very important question: if the alleged virus mutates so much that it has produced over 70,000 different genetic sequences, which of these will be selected for the vaccine?

And how can the vaccine cover anything if the other 69,999 sequences are not covered and the virus, in any case, is constantly mutating?

And here we are with the problem of the tampon, the real engine of this pseudo-pandemic.

As we explained at the beginning, the swab test uses the same technique we saw above for pseudo-isolation, starting with the patient’s presumptively infected fluid.

This liquid is centrifuged, then placed in the predetermined test which should have the viral standard, i.e. the isolated virus, incorporated.

But if the virus has never been isolated, what standard is used?

Various studies have found many mutations and variations between different geographic strains: one article, which also includes Robert Gallo among the authors, found dozens of mutations increasing over time in parallel with the alleged spread of the virus from Asia to Europe to the USA [Pachetti M. et al., Emerging SARS-CoV-2 mutation hot spots include a! Novel RNA-dependent RNA polymerase variant, J Transl Med (2020) 18: 179 https://doi.org/10.1186/s12967-020 -02344-6]; while another author analyzed 85 different SARS-Cov2 genomic sequences available at GISAID, and found 53 different SARS-Cov2 strains from various areas of China, Asia, Europe and the United States.[ Phan Tung, Genetic diversity and evolution of SARS-CoV-2, Infection, Genetics and Evolution,  81 (2020), 104260 ]

So which of these viral strains is looking for the swab?

If the virus constantly changes (assuming and not granted that the virus exists), then the test is useless, because it searches for a virus that is always older than the one currently in circulation.

This alone would be enough to understand that the Covid-19 swab – the test is completely, 100%, fallacious!

This is really what happens in reality.

The “Drosten PCR Test” and the “Institute Pasteur” test, the two tests considered the most reliable (although neither has been externally validated), both use an E gene test, although the Drosten test uses it as a preliminary test, while the Institut Pasteur uses it as a definitive test.

According to the authors of the Drosten test [Corman VM et al., Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR, Euro Surveill. 2020 Jan 23; 25 (3): 2000045.] , the E-gene test is able to detect all Asian viruses, thus being at the same time very non-specific (all viral strains) and limited to a geographical area (Asia).

Furthermore, the Institut Pasteur test, one of the most adopted in Europe, uses the E-Gene test as a final test, although it is now known that the SARS-Cov2 virus (or virus) believed to circulate in Europe would be different from those asians.

And then in April, WHO changed the algorithm “… recommending that from now on a test can be considered positive even if only the dosage of gene E (which will probably detect all Asian viruses!) Gives a positive result ” . [Engelbrecht T, Demeter K., COVID19 PCR Tests are Scientifically Meaningless, Jun 27 2020, p.21. https: // o ff- guardian.org/2020/06/27/covid19-pcr-tests-are-scAR3G6Fuq8C-8XW7szL43scbKOYFx78irq52A6ZQCRdZmPMWiHTqD_2jv4Zo]

Clearly all of this is only good for fueling false positives and the social panic associated with the explosion of the Covid asymptomatic “disease”!

That the Covid-19 swab test is destined to produce many false positives was already found at the beginning in China, when an article [Zonghua L et al, Potential false-positive rate among the ‘asymptomatic infected individuals’ in close contacts of COVID-19 patients, 2020 Mar 5; 41 (4): 485-488.doi: 10.3760 / cma.j.cn112338-20200221-00144]   was published on March 5, 2020 (therefore referring to the tests carried out in February) and reporting a number of 80.3% of false positives.

 Interestingly, after the “pandemic” exploded, the Chinese newspaper withdrew the article!

But the official sanction for the ineffectiveness and total unreliability of the Covid-19 test came from an unexpected area, that of the European Union.

In the Working Document of the European Commission of 16 April, that is, after the peak of the pseudo-pandemic, the European Commission states:

“Timely and accurate COVID-19 tests are an essential part of managing the COVID-19 crisis … after being placed on the market the performance of the devices can be validated, ie confirmed by additional tests confirming the manufacturer’s specifications, for example ex. in reference laboratories, academic institutions or national regulatory agencies.

Such validation is not legally mandatory but highly recommended for public health decision making . “[ European Commission, Working Document of Commission Services, Current performance of COVID-19 test methods and devices and proposed performance criteria, April 16 2020.]

One would expect there to be a standard, a fundamental testing methodology that is validated and pre-authorized.

Here it is not a question of a luxury product left to the management of the free market, but of an instrument that was essential to justify the power of governments to impose the worst dictatorial closure of civil and economic rights that can be remembered in living memory!

Instead, this is the situation described by the EU Commission itself:

“In total, 78 RT-PCR based devices… 101 for antibody detection and 13 for antigen detection were evaluated. “

Of these 78 devices, some imported from China, none have ever been checked or inspected, let alone validated, in advance.

Only 3, “… those of the Institut Pasteur, the Hong Kong Faculty of Medicine and the Charité have been validated internally”, that is, certified as valid by the manufacturer itself, which is equivalent to saying that even those have never been validated or authorized by any independent or governmental body. Moreover:

“The most crucial information in relation to RT-PCR methods for the detection of SARS-CoV-2 are the sequences of the oligonucleotides (primers and probes) used for cDNA amplification … except for a few cases, we could not find no information on the actual sequences of primers and probes used in the devices. “

In other words, devices in circulation could contain any type of thing, as far as the authorities know.

And the same level of unreliability also applies to serological or antibody tests not only because, as we have seen above, more than 100 different types circulate without any prior evaluation or authorization, but because the same fundamental limit that afflicts the serological test is based. the swab, i.e. the absence of a reliable standard due to the failure to isolate the virus.

When we talk about serological we talk about antibodies, and everyone probably thinks that specific antibodies exist for each virus.

Nothing could be further from reality: the antibodies that are found with the serological are only two, and only always those, the IgG and the IgM, the latter early immune responses, while the IgG are generated later.

Now, if they are always and only two, how do you know if they are referring to SARS-Cov2 and not a cold, or emotional stress, a bruise, and so on?

In theory, these antibodies are extracted from the serum, and subjected to the same PCR methodology used for the swab, to see if they are activated in contact with SARS-Cov2.

But since, as we have seen, SARS-Cov2 has never been isolated, and is only an artificial laboratory construction, the serological result is a mere batch, which probably activates or does not activate randomly, without no real relationship with the alleged virus that is the alleged cause of Covid-19.

As of today, the alleged genomic data of hCOV-19 reported by GISAID – International Genomic Institute – report 100,000 viral genomic sequences of hCoV-19 from laboratories around the world, which are generating data on the sequence of the viral genome with an unprecedented speed .

In short, we have entrusted the end of our freedom to such uncontrolled, never validated and never authorized tests, be they swabs or serological!

Thanking everyone for their patience…. in reading this very extensive and complicated text, we hope that it is a starting point for “REFLECTION AND VERIFICATION” of what is fed to us by the Media and Politics… .. not to mention the scientific world…. not strictly neutral ….. to the interests of the world population.

We are open to observations and counter-evaluations … but always with scientific data and evidence … ..

LEAVE A REPLY

Please enter your comment!
Please enter your name here

Questo sito utilizza Akismet per ridurre lo spam. Scopri come vengono elaborati i dati derivati dai commenti.