REPORT ESCLUSIVO: Perché i test per il COVID-19 non rilevano SARS-Cov2

0
283

La diffusione del COVID-19 è monitorata utilizzando tamponi per prelevare fluidi respiratori di origine naso-faringea sui quali si testerà la presenza del virus.

Il materiale biologico prelevato col tampone viene inviato ad un laboratorio di analisi accreditato, dove viene effettuata l’estrazione dell’RNA e attraverso una tecnica chiamata sulla RT-PCR (Reverse Transcriptase- Polymerase Chain Reaction o Trascrittasi Inversa – Reazione a Catena della Polimerasi), rilevata o meno la presenza del virus.

Anche se la rRT-PCR è un test altamente sensibile, la sua affidabilità non è totale.

E’ ben noto che questa tecnologia, come del resto tutte le tecnologie molecolari utilizzate in diagnostica, ha la possibilità di falsi positivi e negativi, le cui percentuali dovrebbero essere accuratamente definite in sede di validazione del test.

I reagenti fondamentali per eseguire il test rRT-PCR, ovvero i primer oligonucleotidici e la sonda, sono disegnati su regioni conservate del genoma virale SARS-CoV-2, ma i coronavirus mostrano frequenti eventi di mutazione e di ricombinazione.

Come questi eventuali eventi possano influire sulla sensibilità del test, soprattutto con l’andare del tempo, non può essere conosciuto.

Inoltre, basse cariche virali in pazienti asintomatici o lievemente sintomatici potrebbero non essere rilevate in modo affidabile mediante rRT-PCR.

Cerchiamo di capire da vicino come funzione la RT-PCR (Reverse Transcriptase- Polymerase Chain Reaction o Trascrittasi Inversa – Reazione a Catena della Polimerasi) e come funzionano tecnicamente

Cos’è il test RT-qPCR?

La reazione a catena della polimerasi (PCR) è un metodo altamente sensibile e specifico per l’amplificazione e la rilevazione dell’acido desossiribonucleico (DNA) [ 1 ].

La sua semplicità concettuale ne ha fatto la tecnica più utilizzata in biologia molecolare e può, in teoria, rilevare anche un singolo frammento di DNA. Pertanto, è ampiamente utilizzato come test diagnostico per una vasta gamma di patogeni batterici, fungini, virali e parassiti.

Tuttavia, il genoma dei coronavirus è costituito da acido ribonucleico (RNA) piuttosto che da DNA.

Sebbene l’RNA sia simile al DNA, è sufficientemente diverso dal fatto che la Taq polimerasi, l’enzima standard utilizzato per l’amplificazione del DNA, lo replica solo in modo molto inefficiente.

Di conseguenza, l’RNA viene rilevato da una variante del test PCR, chiamato trascrizione inversa (RT) -PCR [ 2].

Ciò comprende un metodo in due fasi, tipicamente comprendente due enzimi; la prima fase utilizza una DNA polimerasi RNA-dipendente, nota anche come trascrittasi inversa, per copiare l’RNA nel DNA (cDNA), la seconda fase passa quindi all’uso della Taq polimerasi, che amplifica il cDNA come in un test PCR standard (Figura 1).

Figura 1 – Profilo termico di un tipico test RT-qPCR eseguito su uno strumento BioRad CFX qPCR. Qui, la fase RT viene eseguita a 50 ° C per 15 min, seguita da una disattivazione RT di 3 min e Taqfase di attivazione della polimerasi. La RT è seguita dalla fase PCR, che consiste in una fase di denaturazione di 5 s, durante la quale i filamenti di DNA si separano in singoli filamenti, e una fase di incubazione di ricottura / polimerizzazione a 60 ° C di 45 s, durante la quale i primer di amplificazione (e le sonde di rilevamento ) ibridizzano con i modelli di DNA a filamento singolo e consentono alla polimerasi di replicare lo stampo, creando DNA a doppio filamento. Durante la polimerizzazione di successo, la sonda viene spostata e idrolizzata, separando fluoroforo e quencher e rilasciando fluorescenza. Questo processo viene ripetuto, di solito circa 40 volte (40 cicli). Una tipica corsa RT-qPCR, come esemplificato qui, viene completata in circa 1 ora e 27 minuti. Poiché si tratta di un’esecuzione RT-qPCR,

Ai fini diagnostici, è più conveniente eseguire le reazioni RT e PCR in un’unica provetta; per uso di ricerca, le due fasi vengono spesso eseguite in tubi separati. Esiste un approccio alternativo che utilizza la Tth polimerasi, un enzima termostabile in grado di replicare sia l’RNA che il DNA per eseguire sia le reazioni RT che PCR [ 3 ], ma questo metodo tende ad essere meno sensibile.

La maggior parte dei test diagnostici utilizza una particolare versione del test RT-PCR, denominata RT-PCR quantitativa basata sulla fluorescenza (RT-qPCR) [ 4 ] (figura 2).




Figura 2
Generazione del segnale durante un test RT-qPCR. I reagenti del test includono un tampone, entrambi gli enzimi, primer di DNA specifici per il bersaglio e una sonda di DNA specifica per il bersaglio etichettata a un’estremità con un’etichetta fluorescente e all’altra con un quencher. I campioni a sinistra ea destra contengono gli stessi primer e sonda, ma quello a sinistra contiene l’RNA target, mentre quello a destra no. A. RT: i campioni vengono incubati a circa 50 ° C, il che si traduce nella trascrizione RT del cDNA specifico del bersaglio da uno dei primer specifici del filamento a sinistra, senza trascrizione inversa a destra. B. Denaturazione: i campioni vengono riscaldati a 95 ° C, che denatura l’RNA ma lascia intatto il cDNA. C.Ricottura: la temperatura viene abbassata a circa 60 ° C, con la temperatura effettiva dipendente dal dosaggio. Ciò consente sia ai primer specifici del target che alla sonda di legarsi ai rispettivi target a sinistra, mentre i primer e la sonda rimangono non legati a destra. D.Polimerizzazione: questa fase può essere combinata con la fase di ricottura. A sinistra, la polimerasi estende la sintesi del DNA, inizialmente da un solo primer, ma dopo il primo ciclo da entrambi, e sposta e idrolizza qualsiasi sonda legata. Questo separa il fluoroforo e il quencher e provoca l’emissione di luce se il fluoroforo viene eccitato alla lunghezza d’onda appropriata. A destra, niente di tutto ciò si verifica e non viene emessa luce. Questo primo ciclo è seguito da un ulteriore numero di cicli definito dall’utente, indicato dalla freccia punteggiata che riporta al passaggio B. E. I grafici di amplificazione ottenuti per ciascun campione tracciano la crescente emissione di luce caratteristica di un risultato positivo dal campione a sinistra (grafico in verde), mentre il campione senza target amplificabile a destra registra nessuna emissione di luce e un risultato negativo (grafico in rosso) .

Uno dei preziosi vantaggi di RT-qPCR è la facilità con cui l’RNA in generale e la carica virale in particolare possono essere quantificati, se vengono stabiliti parametri di dosaggio adeguati e sono inclusi controlli appropriati [ 5].

Il ciclo di quantificazione (Cq) è al centro di una quantificazione accurata e riproducibile utilizzando RT-qPCR.

I valori di fluorescenza vengono registrati durante ogni ciclo e rappresentano la quantità di prodotto amplificata fino a quel punto nella reazione di amplificazione.

Più templato è presente all’inizio della reazione, minore è il numero di cicli necessari per raggiungere un punto in cui il segnale fluorescente viene prima registrato come statisticamente significativo sopra lo sfondo.

Questo punto è definito come Cq e si verificherà sempre durante la fase esponenziale di amplificazione.

Pertanto, la quantificazione non è influenzata da eventuali componenti di reazione che diventano limitati nella fase di plateau [ 2 ].

Tuttavia, è importante non fare affidamento esclusivamente sul Cq quando si riportano i risultati, poiché i valori Cq sono soggetti a variazione intrinseca tra le serie [ 6] e non deve essere utilizzato senza adeguati standard di calibrazione [ 5 ].

Un modo ovvio per ottenere una quantificazione affidabile è includere una molecola di RNA di numero di copie noto come un picco con l’RNA dopo l’estrazione.

Ciò consentirebbe sia una misura del controllo di qualità, poiché qualsiasi deviazione dal Cq previsto suggerirebbe una certa inibizione della reazione, sia la determinazione del numero di copie virali rispetto a quel picco.

 Ciò rende possibile segnalare non solo una risposta qualitativa infetta / non infetta, ma anche mirare a includere una valutazione della carica virale per misurare, ad esempio, la progressione della malattia.

In definitiva, l’affidabilità dei risultati di RT-qPCR dipende dalla standardizzazione delle misurazioni [ 7 ], specialmente se usati come strumento diagnostico.

È chiaro che la necessità di poter confrontare i risultati di un’ampia gamma di test, strumenti, laboratori diversi e paesi diversi rende essenziale lo sviluppo di materiali di riferimento, che alla fine sarebbero certificati, per consentire l’armonizzazione dei dati.

Gli ultimi anni hanno visto il progresso della PCR digitale come approccio complementare per misurare gli acidi nucleici che possono essere altamente riproducibili se eseguiti in momenti diversi e quando diversi set di primer prendono di mira la stessa molecola, come nel caso di SARS-CoV-2 [ 8 ].

Sebbene il costo della strumentazione, il throughput, i requisiti infrastrutturali e la penetrazione di RT-dPCR non possano essere paragonati a RT-qPCR, è probabile che questo metodo sia utile come metodo di conferma per casi sospetti di infezione da SARS-CoV-2 [ 9 , 10 ], soprattutto quando si rilevano cariche virali molto basse.

Quali reagenti sono necessari per eseguirlo?

Un test RT-qPCR completo richiede pochi componenti, ognuno dei quali è disponibile in abbondanza.

I reagenti di estrazione dell’RNA utilizzano una serie di sostanze chimiche standard, tra cui isotiocianato di guanidinio e tensioattivi di tritone, e non mancano RT, Taq polimerasi, primer e sonde o componenti per il tampone RT-qPCR.

Ciò rende piuttosto sorprendente l’affermazione del governo britannico di una carenza di reagenti chimici che ritardano test adeguati.

Inoltre, anche se ci fosse una temporanea interruzione delle forniture, la maggior parte dei laboratori è ben fornita e, come con i protocolli PCR, si ottengono facilmente riduzioni significative delle quantità di reagenti utilizzati per test.

 Molte reazioni standard vengono eseguite in volumi da 25 µl, ma è perfettamente fattibile ottenere la stessa sensibilità e accuratezza in volumi di reazione di appena 5 µl.

Come Tabella 1 mostra, questo porta a una significativa diminuzione della quantità di enzima e miscela tampone master richiesta, con l’ulteriore vantaggio di una significativa riduzione dei costi per test.

 Una quantità di 25 ml di miscela enzimatica, sufficiente per 10.000 test, ha un prezzo di listino di circa £ 925 nel Regno Unito (master mix PCRBio OneStep RT-qPCR).

Tabella 1

Riduzione della quantità di miscela enzimatica richiesta per i test RT-qPCR riducendo i volumi del dosaggio.

Volume di RT-qPCRMiscela / test enzimaticoMiscela enzimatica / 10.000 test
(µl)(µl)(ml)
2512.5125
105.050
52.525

Colore grigio: un contrasto.

Quali altre considerazioni ci sono?

I test clinici di laboratorio hanno compiuto notevoli progressi da quando le valutazioni esterne della qualità (EQA) hanno identificato per la prima volta problemi nel confronto dei risultati tra diversi laboratori clinici [ 15 ].

Oggi esistono standard sviluppati dall’International Organization for Standardization, inclusa la serie 20166, che sono specificamente progettati per esami diagnostici molecolari in vitro, nonché standard come ISO 20395: 2019, che elenca i requisiti per valutare le prestazioni dei metodi di quantificazione per le sequenze bersaglio degli acidi nucleici per quanto riguarda qPCR e dPCR.

 L’obiettivo di questi standard è ridurre l’impatto dei fattori esterni sui risultati degli esami, assicurando così che i pazienti ottengano diagnosi il più possibile obiettive.

La fase preanalitica dei test molecolari, che comprende la raccolta, la manipolazione e la conservazione del campione e il potenziale di contaminazione del campione [ 16 ], nonché i problemi relativi all’estrazione degli acidi nucleici [ 17 ], è una delle principali fonti di errori nei test diagnostici di laboratorio.

I campioni per il test PCR per COVID-19 vengono solitamente prelevati dall’interno del naso, dalla bocca o dalla parte posteriore della gola e un attento campionamento e la preparazione degli acidi nucleici sono importanti considerazioni preliminari al test.

È chiaramente necessario massimizzare la probabilità di raccogliere con successo il virus mediante un campionamento meticoloso.

Inoltre, poiché RT-qPCR è inibito da molte sostanze presenti nei campioni umani [ 18], è importante utilizzare metodi di estrazione degli acidi nucleici che rimuovano questi inibitori.

Ovviamente, entrambi i criteri sono particolarmente cruciali per evitare risultati falsi negativi.

È anche diventato evidente che alcuni kit di test commerciali, e in particolare sonde e primer, sono stati contaminati con sequenze SARS-CoV-2, con importanti implicazioni per il rilevamento di falsi positivi.

L’efficienza di un test RT-qPCR è di fondamentale importanza. Esiste un’ampia scelta di enzimi che possono svolgere i due passaggi e tutti differiscono per le loro proprietà.

La fase di conversione dell’RNA è notoriamente variabile e alcune combinazioni di enzimi RT-PCR sono più efficienti di altre [ 19 ].

Poiché la fase PCR amplifica il DNA in modo esponenziale, piccole differenze di efficienza possono provocare grandi differenze nella sensibilità del test.

Di nuovo, questo è molto importante durante le primissime fasi dell’infezione, quando un tampone può raccogliere pochissime particelle virali.

L’affidabilità del test dipende anche dai reagenti utilizzati per consentire all’enzima di amplificare e rilevare il suo target.

Questi sono i primer e la sonda specifici per SARS-CoV-2, che devono essere specifici al 100% per il virus e quindi amplificare solo le sequenze virali e riportare la quantità crescente di amplicone PCR sintetizzato.

Esistono diverse regioni genomiche virali prese di mira dai saggi RT-qPCR e più modelli di primer che mirano agli stessi geni.

Questi includono il gene RdRP (gene RNA polimerasi RNA-dipendente), il gene E (gene della proteina busta) e il gene Ngene (gene della proteina nucleocapsidica).

È importante notare che due diversi set di primer possono essere entrambi specifici al 100% per il loro target, ma mostrano diverse efficienze di amplificazione e quindi determinano sensibilità diverse dei saggi [ 20 ].

Questo è stato osservato per i saggi SARS-CoV-2, dove sono state riportate differenze nelle prestazioni dei vari test [ 21 , 22 ] che possono essere dovute a differenze nell’efficienza di priming o nei protocolli utilizzati, o possono essere associate a RNA virale secondario struttura o stabilità.

I primer sono probabilmente il componente più critico di un test RT-qPCR affidabile, poiché le loro proprietà controllano la squisita specificità e sensibilità che rendono questo metodo straordinariamente potente [ 19].

Ciò è particolarmente vero per i test RT-qPCR a provetta singola generalmente utilizzati per rilevare SARS-CoV-2, poiché l’RNA virale ha un’ampia struttura secondaria, che ha un impatto sostanziale sull’efficienza della trascrizione inversa e quindi la sensibilità e l’affidabilità di l’intero saggio [ 5 ].

Di conseguenza, un design scadente combinato con la mancata ottimizzazione delle condizioni di reazione è probabile che spieghi risultati falsi negativi, con sequenze di RNA variabili all’interno del gene ORF1ab e geni N una possibile causa di risultati negativi o di bassa sensibilità [ 23 ].

Riferimenti

1. Mullis K., Faloona F., Saiki R., Horn G., Erlich H., Scharf S. Amplificazione enzimatica specifica del DNA in vitro: la reazione a catena della polimerasi. Cold Spring Harb. Symp. Quant. Bollire. 1986; 51 : 263–273. doi: 10.1101 / SQB.1986.051.01.032. [ PubMed ] [ CrossRef ] [ Google Scholar ]

2. Bustin S. Quantificazione assoluta dell’mRNA mediante saggi di reazione a catena della polimerasi a trascrizione inversa in tempo reale. J. Mol. Endocrinol. 2000; 25 : 169–193. doi: 10.1677 / jme.0.0250169. [ PubMed ] [ CrossRef ] [ Google Scholar ]

3. Myers TW, Gelfand DH Trascrizione inversa e amplificazione del DNA mediante DNA polimerasi Thermus thermophilus. Biochimica. 1991; 30 : 7661–7666. doi: 10.1021 / bi00245a001. [ PubMed ] [ CrossRef ] [ Google Scholar ]

4. Bustin SA AZ di Quantitative PCR. IUL Press; La Jolla, CA, USA: 2004. [ Google Scholar ]

5. Bustin S., Benes V., Garson JA, Hellemans J., Huggett J., Kubista M., Mueller R., Nolan T., Pfaffl M., Shipley GL, et al. Le linee guida MIQE: informazioni minime per la pubblicazione di esperimenti di PCR quantitativa in tempo reale. Clin. Chem. 2009; 55 : 611–622. doi: 10.1373 / clinchem.2008.112797. [ PubMed ] [ CrossRef ] [ Google Scholar ]

6. Hellemans J., Mortier G., De Paepe A., Speleman F., Vandesompele J. qBase framework di quantificazione relativa e software per la gestione e l’analisi automatizzata di dati PCR quantitativi in ​​tempo reale. Genome Boil. 2007; 8 : R19. doi: 10.1186 / gb-2007-8-2-r19. [ Articolo gratuito di PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]

7. Sanders R., Bustin S., Huggett J., Mason D. Miglioramento della standardizzazione della misurazione dell’mRNA mediante RT-qPCR. Biomol. Rileva. Quantif. 2018; 15 : 13-17. doi: 10.1016 / j.bdq.2018.03.001. [ Articolo gratuito di PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]

8. Sanders R., Huggett JF, Bushell CA, Cowen S., Scott DJ, Foy CA Valutazione della PCR digitale per la quantificazione assoluta del DNA. Anal Chem. 2011; 83 : 6474–6484. doi: 10.1021 / ac103230c. [ PubMed ] [ CrossRef ] [ Google Scholar ]

9. Dong L., Zhou J., Niu C., Wang Q., Pan Y., Sheng S., Wang X., Zhang Y., Yang J., Liu M., et al. Rilevamento diagnostico estremamente preciso e sensibile di SARS-CoV-2 mediante PCR digitale. medRxiv. Doi 2020: 10.1101 / 2020.03.14. [ CrossRef ] [ Google Scholar ]

10. Yu F., Yan L., Wang N., Yang S., Wang L., Tang Y., Gao G., Wang S., Ma C., Xie R., et al. Rilevazione quantitativa e analisi della carica virale di SARS-CoV-2 in pazienti infetti. Clin Infect Dis. 2020 doi: 10.1093 / cid / ciaa345. [ Articolo gratuito di PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]

11. Bustin S. Come accelerare la reazione a catena della polimerasi. Biomol. Rileva. Quantif. 2017; 12 : 10–14. doi: 10.1016 / j.bdq.2017.05.002. [ Articolo gratuito di PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]

12. Farrar JS, Wittwer CT Extreme PCR: Amplificazione del DNA efficiente e specifica in 15–60 secondi. Clin. Chem. 2015; 61 : 145–153. doi: 10.1373 / clinchem.2014.228304. [ PubMed ] [ CrossRef ] [ Google Scholar ]

13. Notomi T. Amplificazione isotermica del DNA mediata dal loop. Ris. Acidi nucleici 2000; 28 : 63. doi: 10.1093 / nar / 28.12.e63. [ Articolo gratuito di PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]

14. Lu R., Wu X., Wan Z., Li Y., Zuo L., Qin J., Jin X., Zhang C.Sviluppo di un nuovo metodo di amplificazione isotermica mediato da loop di trascrizione inversa per il rilevamento rapido della SARS -CoV-2. Virol. Peccato. 2020: 1–4. doi: 10.1007 / s12250-020-00218-1. [ Articolo gratuito di PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]

15. Belk WP, Sunderman FW A Survey of the Accuracy of Chemical Analysis in Clinical Laboratories. Am. J. Clin. Pathol. 1947; 17 : 853–861. doi: 10.1093 / ajcp / 17.11.853. [ PubMed ] [ CrossRef ] [ Google Scholar ]

16. Lippi G., Simundic AM European Federation for Clinical Chemistry; Gruppo di lavoro di medicina di laboratorio (EFLM) per la fase preanalitica WG-PRE. La strategia EFLM per l’armonizzazione della fase preanalitica. Clin. Chem. Laboratorio. Med. 2018; 56 : 1660–1666. doi: 10.1515 / cclm-2017-0277. [ PubMed ] [ CrossRef ] [ Google Scholar ]

17. Bustin SA, Nolan T. Template Manipolazione, preparazione e quantificazione. In: Bustin SA, editore. AZ di Quantitative PCR. International University Line; La Jolla, CA, USA: 2004. pp. 143–213. [ Google Scholar ]

18. Dheda K., Huggett J., Bustin S., Johnson MA, Rook G., Zumla A. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques. 2004; 37 : 112–119. doi: 10.2144 / 04371RR03. [ PubMed ] [ CrossRef ] [ Google Scholar ]

19. Bustin S., Dhillon HS, Kirvell S., Greenwood C., Parker M., Shipley GL, Nolan T. Variability of the Reverse Transcription Step: Practical Implications. Clin. Chem. 2015; 61 : 202–212. doi: 10.1373 / clinchem.2014.230615. [ PubMed ] [ CrossRef ] [ Google Scholar ]

20. Bustin S., Huggett J. qPCR design del primer rivisitato. Biomol. Rileva. Quantif. 2017; 14 : 19–28. doi: 10.1016 / j.bdq.2017.11.001. [ Articolo gratuito di PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]

21. Corman VM, Landt O., Kaiser M., Molenkamp R., Meijer A., ​​Chu DK, Bleicker T., Brünink S., Schneider J., Schmidt ML, et al. Rilevamento del nuovo coronavirus del 2019 (2019-nCoV) mediante RT-PCR in tempo reale. Eurosurveillance. 2020; 25 : 2000045. doi: 10.2807 / 1560-7917.ES.2020.25.3.2000045. [ Articolo gratuito di PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]

22. Chan JF-W., Yip CC-Y., To KK-W., Tang TH-C., Wong SC-Y., Leung K.-H., Fung AY-F., Ng AC-K. , Zou Z., Tsoi H.-W., et al. Diagnosi molecolare migliorata di COVID-19 mediante il nuovo test di reazione a catena della polimerasi con trascrizione inversa in tempo reale altamente sensibile e specifico COVID-19-RdRp / Hel convalidato in vitro e con campioni clinici. J. Clin. Microbiol. : 2020. doi: 10.1128 / JCM.00310-20. [ Articolo gratuito di PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]

23. Wang Y., Kang H., Liu X., Tong Z.-H. La combinazione del test RT-qPCR e delle caratteristiche cliniche per la diagnosi di COVID-19 facilita la gestione dell’epidemia di SARS-CoV-2. J. Med. Virol. 2020; 92 : 538–539. doi: 10.1002 / jmv.25721. [ Articolo gratuito di PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]


Pertanto, il test Covid dipende essenzialmente dall’avvenuto o non avvenuto isolamento originale del virus SARS-Cov2, perché l’isolamento originale PCR del virus costituisce il golden standard necessario per convalidare i successivi successivi test Covid.

I problemi con l’isolamento del virus originale, e quindi con il conseguente test del tampone, sono tanti, e tutti puntano alla verità che il virus SARS-Cov2 non è mai stato isolato e mai testato per la sua patogenicità.

Come è noto, alla base della microbiologia ci sono i famosi Postulati di Koch, che stabiliscono principi di buon senso della ricerca microbiologica: per determinare che un microrganismo è causa di una malattia bisogna procedere attraverso 4 passaggi fondamentali:

a)     Isolare fisicamente i microrganismi, attraverso metodi di filtraggio, da un paziente malato;

b)     Crescere i microrganismi isolati in un brodo di coltura;

c)      Iniettare questo brodo di microrganismi in una cavia, e valutare se i sintomi generati da quell’iniezione sono simili ai sintomi del paziente originale;

d)     Isolare di nuovo il microrganismo dal paziente appena infettato e coltivarlo in un brodo di coltura.

Questi postulati sono stati applicati a microrganismi vivi come batteri, ma poiché sono postulati logici si applicano anche a “non organismi” non viventi come i virus, che sono particelle non viventi costituite da un filamento di RNA (o DNA) ricoperto da un involucro (capside) lipoproteico.

Ebbene, anche se è stato pubblicato almeno un articolo in cui si afferma che i postulati di Koch’s sono stati soddisfatti, la realtà è che il virus SARS-Cov2 non è mai stato isolato e testato.

Ho esaminato tutti gli studi che affermano di aver isolato e  persino testato il virus, ma tutti hanno fatto qualcosa di molto diverso:  hanno preso  il liquido faringeo o bronco-alveolare dei pazienti, quindi lo hanno centrifugato per separare le molecole più grandi e pesanti dalle molecole più piccole e più leggere, come appunto i presunti virus; hanno poi preso il surnatante (la parte superiore del materiale centrifugato) e hanno chiamato quella matrice estremamente complessa ‘“ virus isolato” a cui poi hanno poi applicato la RT-PCR.[ Zhu N et al, A Novel Coronavirus from Patients with Pneumonia in China, 2019, N Engl J Med. 2020 Feb 20; 382(8): 727–733 – https://www.nejm.org/doi/full/10.1056/nejmoa2001017]

Come da studio originale :

“ISOLAMENTO DEL VIRUS

Campioni di fluido di lavaggio broncoalveolare sono stati raccolti in tazze sterili a cui è stato aggiunto il mezzo di trasporto del virus. I campioni sono stati quindi centrifugati per rimuovere i detriti cellulari.

Il surnatante è stato inoculato su cellule epiteliali delle vie aeree umane, [Jonsdottir HR, Dijkman R. Coronaviruses and the human airway: a universal system for virus-host interaction studies. Virol J 2016;13:24-24.] che erano state ottenute da campioni delle vie aeree resecate da pazienti sottoposti a intervento chirurgico per cancro ai polmoni e sono state confermate prive di agenti patogeni speciali da NGS. [Palacios G, Druce J, Du L, et al. A new arenavirus in a cluster of fatal transplant-associated diseases. N Engl J Med 2008;358:991-998.]

Le cellule epiteliali delle vie aeree umane sono state espanse su substrato di plastica per generare cellule di passaggio 1 e successivamente sono state piastrate a una densità di 2,5 × 10 5 cellule per pozzetto su supporti permeabili Transwell-COL (diametro 12 mm). Le colture di cellule epiteliali delle vie aeree umane sono state generate in un’interfaccia aria-liquido per 4-6 settimane per formare colture ben differenziate e polarizzate simili all’epitelio mucociliare pseudostratificato in vivo. [Jonsdottir HR, Dijkman R. Coronaviruses and the human airway: a universal system for virus-host interaction studies. Virol J 2016;13:24-24.]

Prima dell’infezione, le superfici apicali delle cellule epiteliali delle vie aeree umane sono state lavate tre volte con soluzione salina tamponata con fosfato; 150 μl di surnatante da campioni di liquido di lavaggio broncoalveolare sono stati inoculati sulla superficie apicale delle colture cellulari.

Dopo un’incubazione di 2 ore a 37 ° C, il virus non legato è stato rimosso lavando con 500 μl di soluzione salina tamponata con fosfato per 10 minuti; le cellule epiteliali delle vie aeree umane sono state mantenute in un’interfaccia aria-liquido incubate a 37 ° C con anidride carbonica al 5%.

Ogni 48 ore, 150 μl di soluzione salina tamponata con fosfato sono stati applicati alle superfici apicali delle cellule epiteliali delle vie aeree umane e dopo 10 minuti di incubazione a 37 ° C i campioni sono stati raccolti. Le cellule dell’epitelio mucociliare pseudostratificato sono state mantenute in questo ambiente; campioni apicali sono stati fatti passare in un brodo di fiala diluito 1: 3 a nuove cellule. Le cellule sono state monitorate giornalmente con microscopia ottica, per gli effetti citopatici, e con RT-PCR, per la presenza di acido nucleico virale nel surnatante. Dopo tre passaggi, campioni apicali e cellule epiteliali delle vie aeree umane sono stati preparati per la microscopia elettronica a trasmissione.”

E per non annoiarci…… riportiamo ciò che è stato fatto per sequenziare il cosiddetto “genoma virale”… del presunto COVID-19…

“SEQUENZIAMENTO DEL GENOMA VIRALE

L’RNA estratto dal fluido di lavaggio broncoalveolare e dai supernatanti di coltura è stato utilizzato come modello per clonare e sequenziare il genoma.

Abbiamo utilizzato una combinazione di sequenziamento Illumina e sequenziamento di nanopori per caratterizzare il genoma del virus. Le letture delle sequenze sono state assemblate in mappe contig (un insieme di segmenti di DNA sovrapposti) con l’uso del software CLC Genomics, versione 4.6.1 (CLC Bio).

Successivamente sono stati progettati primer specifici per la PCR e 5′- o 3′-RACE (amplificazione rapida delle estremità del cDNA) è stato utilizzato per colmare le lacune genomiche dal sequenziamento di Sanger convenzionale.

Questi prodotti PCR sono stati purificati dai gel e sequenziati con un kit di sequenziamento del ciclo BigDye Terminator v3.1 e un analizzatore genetico 3130XL, in conformità con le istruzioni dei produttori.”

L’allineamento di sequenze multiple del 2019-nCoV e delle sequenze di riferimento è stato eseguito con l’uso di Muscle. L’analisi filogenetica dei genomi completi è stata eseguita con RAxML (13) con 1000 replicati di bootstrap e un modello generale reversibile nel tempo utilizzato come modello di sostituzione nucleotidica.

È una cosa piuttosto tecnica, ma cercherò di semplificare: il surnatante contiene diversi tipi di molecole, miliardi di diverse micro e nano particelle, comprese quelle che vengono chiamate vescicole extracellulari (EVs) ed esosomi, particelle utili prodotte dal nostro corpo e assolutamente indistinguibili dai virus:

“Al giorno d’oggi, è una missione quasi impossibile separare vescicole extracellulari e virus attraverso i metodi canonici di isolamento delle vescicole, come quello della ultra-centrifugazione differenziale, perché sono spesso co-pellettati (raccolti assieme) a causa della loro dimensione simile.”  [Giannessi F. et al., The Role of Extracellular Vesicles as Allies of HIV, HCV and SARS Viruses, Viruses 2020, 12, 571; doi:10.3390/v12050571, p.4.]

Tradotto scientificamente …..

Vescicole extracellulari (EV)e virus: parenti stretti?

Negli ultimi decenni, la somiglianza tra Vescicole extracellulari (EV) e particelle virali è diventata sempre più evidente.

 I virus e le Vescicole extracellulari (EV) condividono diversi aspetti come le dimensioni, la composizione strutturale e biochimica e il trasporto di molecole bioattive all’interno delle cellule [ 34 , 35].

Come le Vescicole extracellulari (EV), i virus presentano una dimensione che va da 30 a 1000 nm, a partire da quelli piccoli, come le particelle di poliovirus e virus dell’epatite A (HAV), che possiedono un diametro di circa 30 nm, fino al virus dell’epatite C (HCV ) di circa 50 nm e virus HIV o SARS di circa 100-120 nm.

Infine, i mimivirus hanno una dimensione di circa 400 nm. Inoltre, gli EV e alcuni virus hanno somiglianze morfologiche: come descritto in precedenza, gli EV sono entità racchiuse a doppia membrana e anche i virus avvolti sono circondati da una membrana lipidica acquisita dalla cellula.

È interessante notare che possiedono una composizione lipidica simile arricchita in glicosfingolipidi e colesterolo, nonché un contenuto proteico simile.

In particolare, sia i Vescicole extracellulari (EV)che i virus trasportano acidi nucleici; mentre i virus presentano genomi di RNA o DNA a singolo o doppio filamento,35 , 37 , 38 ]. Anche gli EV e i virus con involucro condividono processi di biogenesi simili poiché entrambi sono generati nella rete endosomiale o germogliano dalla membrana plasmatica utilizzando percorsi specifici [ 18 ].

Ad esempio, alcuni retrovirus come l’HIV dirottano i meccanismi di vescicolazione cellulare per favorire la propria replicazione e germogliamento. A questo proposito, è stato riportato che il complesso di smistamento endosomiale (ESCRT), lo stesso che media l’inaginazione verso l’interno degli ILV negli MVB, è anche coinvolto nel germogliamento e nel rilascio di particelle di HIV [ 39 , 40 ].

Inoltre, proprio come i Vescicole extracellulari (EV)possono essere generati da percorsi indipendenti da ESCRT, alcuni virus germogliano da domini di membrana specifici [ 41].

Questi domini, chiamati lipid rafts, sono arricchiti in glicosfingolipidi, colesterolo e ceramide. Inoltre, proteine ​​come le tetraspanine sono immagazzinate in questi domini e formano cluster tra loro e altre proteine ​​transmembrana e citosoliche, inducendo così il germogliamento verso l’interno dei microdomini in cui sono arricchite [ 42 ].

Come accennato in precedenza, anche le composizioni specifiche di glicocalice svolgono un ruolo nel rilascio delle vescicole; tuttavia, il glicocalice può anche essere coinvolto in altri processi di membrana, compreso l’assorbimento di alcuni virus [ 43 ].

A questo proposito, alcuni virus si sono evoluti per sfruttare glicani specifici per entrare nelle cellule, come i rotavirus umani che legano gli antigeni del gruppo sanguigno A [ 44 ].

 Invece, nel caso dell’HIV [ 45], Virus Ebola [ 46 ], HCV [ 47 ], così come i virus dell’influenza [ 48 ] o della sindrome respiratoria acuta grave (SARS) [ 49 ], i virus stessi presentano glicani sulla loro superficie. La loro presenza sulle superfici virali è sfruttata dalle cellule immunitarie, come i macrofagi o le cellule dendritiche, per i virioni dei fagociti.

A loro volta, i virus Ebola [ 46 ] e SARS [ 49 ] sfruttano questo sistema antivirale per entrare e replicarsi nei macrofagi e nelle cellule dendritiche. D’altra parte, i glicani sono anche usati dai virus per creare uno scudo che nasconde epitopi virali alle cellule immunitarie, come accade con l’HIV, noto per avere la più alta densità di glicani attaccati alle sue proteine ​​di superficie [ 50] e il virus Lassa [ 51 ].

La sostanziale sovrapposizione dei processi di biogenesi fornisce una spiegazione plausibile per la composizione simile osservata tra EV e virus con involucro [ 39 ].

Inoltre, sia gli EV che i virus con involucro possono legarsi alla membrana plasmatica delle cellule riceventi e, dopo eventi di fusione, direttamente con la membrana di superficie o dopo l’endocitosi, rilasciano il loro carico luminale nel citosol, influenzando l’attività cellulare [ 18 ].

 A questo proposito, in modo simile alle proteine ​​dell’involucro virale, le proteine ​​di superficie EV, come la molecola di adesione intercellulare 1 (ICAM-1), mediano l’adesione e l’internalizzazione degli EV nelle cellule bersaglio [ 52 ].

Pertanto, sia le Vescicole extracellulari (EV)che i virus possono essere considerati strutture bioattive in grado di influenzare il comportamento cellulare.

La presenza di molteplici somiglianze tra virus (in particolare retrovirus) ed EV, ha immediatamente innescato congetture sulla reale relazione tra vescicole e virus.

Per questo motivo sono state proposte due teorie alternative. La prima, chiamata “ipotesi esosoma troiana”, afferma che i retrovirus sono vescicole evolute a seguito di una mutazione del gene gag , originariamente codificato da un retro-trasposone integrato che ha diretto il suo prodotto di espressione verso il percorso di generazione delle vescicole.

In questa prospettiva, le caratteristiche tipiche dei retrovirus sarebbero state acquisite dalla divergenza evolutiva; il meccanismo di biogenesi preesistente della produzione di vescicole sarebbe stato utilizzato per formare particelle virali [ 53].

La seconda teoria non associa i virus agli esosomi modificati. Giustifica le somiglianze, dando maggiore importanza al fenomeno dell’evoluzione convergente, che porterebbe alla condivisione delle stesse vie di biogenesi per vescicole e virus [ 54 ].

 Entrambe le teorie forniscono una giustificazione plausibile per le affinità osservate tra virus ed EV.

Tuttavia, indipendentemente dalla loro possibile origine, queste affinità hanno certamente un impatto negativo sulla sorveglianza immunologica nell’ospite, poiché i virus, durante le infezioni, possono trarre vantaggio da queste affinità per sfuggire al sistema immunitario imitando la composizione e il comportamento delle vescicole [ 55 ].

La notevole somiglianza tra Vescicole extracellulari (EV)e virus ha causato parecchi problemi negli studi focalizzati sull’analisi dei Vescicole extracellulari (EV)rilasciati durante le infezioni virali.

Al giorno d’oggi, è una missione quasi impossibile separare EV e virus mediante metodi canonici di isolamento delle vescicole, come l’ultracentrifugazione differenziale, perché sono spesso co-pellettati a causa della loro dimensione simile [ 56 , 57 ].

Per superare questo problema, diversi studi hanno proposto la separazione degli EV dalle particelle virali sfruttando la loro diversa velocità di migrazione in un gradiente di densità o utilizzando la presenza di marcatori specifici che distinguono i virus dagli EV [ 56 , 58 , 59].

Tuttavia, ad oggi, non esiste un metodo affidabile che possa effettivamente garantire una separazione completa.

*[reference link : The Role of Extracellular Vesicles as Allies of HIV, HCV and SARS Viruses – https://www.mdpi.com/1999-4915/12/5/571/htm

18.     Colombo, M.; Raposo, G.; Théry, C. Biogenesis, secretion, and intercellular interactions of exosomes and other extracellular vesicles. Annu. Rev. Cell Dev. Biol. 2014, 30, 255–289.  [Google Scholar] [CrossRef]

  • 34 Schorey, J.S.; Cheng, Y.; Singh, P.P.; Smith, V.L. Exosomes and other extracellular vesicles in host–pathogen interactions. EMBO Rep. 201516, 24–43. [Google Scholar] [CrossRef] [PubMed]
  • 35 Valadi, H.; Ekström, K.; Bossios, A.; Sjöstrand, M.; Lee, J.J.; Lötvall, J.O. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat. Cell Biol. 20079, 654–659. [Google Scholar] [CrossRef]
  • 36 Aiello, A.; Giannessi, F.; Percario, Z.A.; Affabris, E. An emerging interplay between extracellular vesicles and cytokines. Cytokine Growth Factor Rev. 202051, 49–60. [Google Scholar] [CrossRef]
  • 37 Nolte-’t Hoen, E.N.M.; Buermans, H.P.J.; Waasdorp, M.; Stoorvogel, W.; Wauben, M.H.M.; ’t Hoen, P.A.C. Deep sequencing of RNA from immune cell-derived vesicles uncovers the selective incorporation of small non-coding RNA biotypes with potential regulatory functions. Nucleic Acids Res. 201240, 9272–9285. [Google Scholar] [CrossRef]
  • 38 Vojtech, L.; Woo, S.; Hughes, S.; Levy, C.; Ballweber, L.; Sauteraud, R.P.; Strobl, J.; Westerberg, K.; Gottardo, R.; Tewari, M.; et al. Exosomes in human semen carry a distinctive repertoire of small non-coding RNAs with potential regulatory functions. Nucleic Acids Res. 201442, 7290–7304. [Google Scholar] [CrossRef]
  • 39 Morita, E.; Sundquist, W.I. Retrovirus budding. Annu. Rev. Cell Dev. Biol. 200420, 395–425. [Google Scholar] [CrossRef]
  • 40 Bieniasz, P.D. Late budding domains and host proteins in enveloped virus release. Virology 2006344, 55–63. [Google Scholar] [CrossRef]
  • 41 Nguyen, D.H.; Hildreth, J.E. Evidence for budding of human immunodeficiency virus type 1 selectively from glycolipid-enriched membrane lipid rafts. J. Virol. 200074, 3264–3272. [Google Scholar] [CrossRef] [PubMed]
  • 42 Trajkovic, K.; Hsu, C.; Chiantia, S.; Rajendran, L.; Wenzel, D.; Wieland, F.; Schwille, P.; Brügger, B.; Simons, M. Ceramide triggers budding of exosome vesicles into multivesicular endosomes. Science 2008319, 1244–1247. [Google Scholar] [CrossRef] [PubMed]
  • 43 Le Mercier, P.; Mariethoz, J.; Lascano-Maillard, J.; Bonnardel, F.; Imberty, A.; Ricard-Blum, S.; Lisacek, F. A Bioinformatics View of Glycan-Virus Interactions. Viruses 201911, 374. [Google Scholar] [CrossRef] [PubMed]
  • 44 Böhm, R.; Fleming, F.E.; Maggioni, A.; Dang, V.T.; Holloway, G.; Coulson, B.S.; von Itzstein, M.; Haselhorst, T. Revisiting the role of histo-blood group antigens in rotavirus host-cell invasion. Nat. Commun. 20156, 5907. [Google Scholar] [CrossRef] [PubMed]
  • 45 da Silva, R.C.; Segat, L.; Crovella, S. Role of DC-SIGN and L-SIGN receptors in HIV-1 vertical transmission. Hum. Immunol. 201172, 305–311. [Google Scholar] [CrossRef] [PubMed]
  • 46 Simmons, G.; Reeves, J.D.; Grogan, C.C.; Vandenberghe, L.H.; Baribaud, F.; Whitbeck, J.C.; Burke, E.; Buchmeier, M.J.; Soilleux, E.J.; Riley, J.L.; et al. DC-SIGN and DC-SIGNR bind ebola glycoproteins and enhance infection of macrophages and endothelial cells. Virology 2003305, 115–123. [Google Scholar] [CrossRef]
  • 47 Lai, W.K.; Sun, P.J.; Zhang, J.; Jennings, A.; Lalor, P.F.; Hubscher, S.; McKeating, J.A.; Adams, D.H. Expression of DC-SIGN and DC-SIGNR on Human Sinusoidal Endothelium. Am. J. Pathol. 2006169, 200–208. [Google Scholar] [CrossRef]
  • 48 Londrigan, S.L.; Turville, S.G.; Tate, M.D.; Deng, Y.-M.; Brooks, A.G.; Reading, P.C. N-linked glycosylation facilitates sialic acid-independent attachment and entry of influenza A viruses into cells expressing DC-SIGN or L-SIGN. J. Virol. 201185, 2990–3000. [Google Scholar] [CrossRef]
  • 49 Yang, Z.-Y.; Huang, Y.; Ganesh, L.; Leung, K.; Kong, W.-P.; Schwartz, O.; Subbarao, K.; Nabel, G.J. pH-dependent entry of severe acute respiratory syndrome coronavirus is mediated by the spike glycoprotein and enhanced by dendritic cell transfer through DC-SIGN. J. Virol. 200478, 5642–5650. [Google Scholar] [CrossRef]
  • 50 Bonomelli, C.; Doores, K.J.; Dunlop, D.C.; Thaney, V.; Dwek, R.A.; Burton, D.R.; Crispin, M.; Scanlan, C.N. The glycan shield of HIV is predominantly oligomannose independently of production system or viral clade. PLoS ONE 20116, e23521. [Google Scholar] [CrossRef]
  • 51 Watanabe, Y.; Raghwani, J.; Allen, J.D.; Seabright, G.E.; Li, S.; Moser, F.; Huiskonen, J.T.; Strecker, T.; Bowden, T.A.; Crispin, M. Structure of the Lassa virus glycan shield provides a model for immunological resistance. Proc. Natl. Acad. Sci. USA 2018115, 7320–7325. [Google Scholar] [CrossRef]
  • 52 Segura, E.; Nicco, C.; Lombard, B.; Véron, P.; Raposo, G.; Batteux, F.; Amigorena, S.; Théry, C. ICAM-1 on exosomes from mature dendritic cells is critical for efficient naive T-cell priming. Blood 2005106, 216–223. [Google Scholar] [CrossRef] [PubMed]
  • 53 Gould, S.J.; Booth, A.M.; Hildreth, J.E.K. The Trojan exosome hypothesis. Proc. Natl. Acad. Sci. USA 2003100, 10592–10597. [Google Scholar] [CrossRef] [PubMed]
  • 54 Pelchen-Matthews, A.; Raposo, G.; Marsh, M. Endosomes, exosomes and Trojan viruses. Trends Microbiol. 200412, 310–316. [Google Scholar] [CrossRef] [PubMed]
  • 55 Izquierdo-Useros, N.; Puertas, M.C.; Borràs, F.E.; Blanco, J.; Martinez-Picado, J. Exosomes and retroviruses: The chicken or the egg? Cell. Microbiol. 201113, 10–17. [Google Scholar] [CrossRef] [PubMed]
  • 56 Eckner, R.J.; Hettrick, K.L. Defective Friend Spleen Focus-Forming Virus: Interfering Properties and Isolation Free from Standard Leukemia-Inducing Helper Virus. J. Virol. 197724, 383–396. [Google Scholar] [CrossRef] [PubMed]
  • 57 Théry, C.; Witwer, K.W.; Aikawa, E.; Alcaraz, M.J.; Anderson, J.D.; Andriantsitohaina, R.; Antoniou, A.; Arab, T.; Archer, F.; Atkin-Smith, G.K.; et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): A position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J. Extracell. Vesicles 20187, 1535750. [Google Scholar] [CrossRef]
  • 58 Cantin, R.; Diou, J.; Bélanger, D.; Tremblay, A.M.; Gilbert, C. Discrimination between exosomes and HIV-1: Purification of both vesicles from cell-free supernatants. J. Immunol. Methods 2008338, 21–30. [Google Scholar] [CrossRef]
  • 59 Konadu, K.A.; Huang, M.B.; Roth, W.; Armstrong, W.; Powell, M.; Villinger, F.; Bond, V. Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals. J. Vis. Exp. 2016107, e53495. [Google Scholar] [CrossRef]

Se quello che avete letto sino ad ora sembra sconvolgente….. allora vi chiedo di sedervi se non lo siete già…

Essendo una persona molto curiosa, ho iniziato a ricercare sui siti istituzionali la sequenza genomica utilizzata dalla WHO per identificare il COVID-19 nei test PCR.

Il documento principale da cui sono partito è stato questo : Protocol: Real-time RT-PCR assays for the detection of SARS-CoV-2 Institut Pasteur, Paris , rintracciabile ufficialmentesul sito della WHO all’indirizzo https://www.who.int/docs/default-source/coronaviruse/real-time-rt-pcr-assays-for-the-detection-of-sars-cov-2-institut-pasteur-paris.pdf?sfvrsn=3662fcb6_2.

Riporto quindi quanto citato ufficialmente :

“Questo protocollo descrive le procedure per il rilevamento di SARS-CoV-2 per due target RdRp (IP2 e IP4).

Sulla base delle prime sequenze di SARS-CoV-2 rese disponibili sul database GISAID l’11 gennaio 2020, primer e sonde (nCoV_IP2 e nCoV_IP4) sono stati progettati per colpire il gene RdRp che si estende tra nt 12621-12727 e 14010-14116 (posizioni secondo SARS-CoV, NC_004718).

Come test di conferma, abbiamo utilizzato il test del gene E dal protocollo Charité 1

Materiale

Kit:

Kit di estrazione NucleoSpin Dx Virus Rif: Macherey Nagel 740895.50 SuperScript ™ III Platinum® Sistema RT-PCR quantitativo in una fase Rif: Invitrogen 1732-020

Primer e sonde

NomeSequenze (5′-3 ‘)Lunghezza (basi)PCR taglia del prodottoRif.
Gene RdRp / nCoV_IP2
nCoV_IP2-12669FwATGAGCTTAGTCCTGTTG17  108 bp  1
nCoV_IP2-12759RvCTCCCTTTGTTGTGTTGT18
nCoV_IP2-12696bProbe (+)AGATGTCTTGTGCTGCCGGTA [5 ‘] Hex [3’] BHQ-121
Gene RdRp / nCoV_IP4
nCoV_IP4-14059FwGGTAACTGGTATGATTTCG19  107 bp  1
nCoV_IP4-14146RvCTGGTCAAGGTTAATATAGG20
nCoV_IP4-14084Probe (+)TCATACAAACCACGCCAGG [5 ‘] Fam [3’] BHQ-119
E gene / E_Sarbeco
E_Sarbeco_F1ACAGGTACGTTAATAGTTAATAGCGT18  125 bp  2
E_Sarbeco_R2ATATTGCAGCAGTACGCACACA20
E_Sarbeco_P1ACACTAGCCATCCTTACTGCGCTTCG [5 ‘] Fam [3’] BHQ-120

1 / Centro nazionale di riferimento per i virus respiratori, Institut Pasteur, Parigi. 2 / Corman et al. Eurosurveillance 1

……

Ho iniziato subito una ricerca nel database NCBI per le sequenze nucleotidiche, e questo mi  ha portato a una scoperta sorprendente.

Una delle sequenze di primer dell’OMS nel test PCR per SARS-CoV-2 si trova in tutto il DNA umano!

La sequenza “CTCCCTTTGTTGTGTTGT” è una sequenza di primer di 18 caratteri che si trova nel documento del protocollo del test PCR del coronavirus dell’OMS.

Le sequenze dei primer sono ciò che viene amplificato dal processo PCR per essere rilevato e designato come risultato del test “positivo”.

Accade così che questa identica sequenza di 18 caratteri, letteralmente, si trovi anche sul cromosoma 8 dell’Homo sapiens!

Homo sapiens chromosome 8, GRCh38.p12 Primary Assembly
Sequence ID: NC_000008.11 Length: 145138636
Range 1: 63648346 to 63648363 is “CTCCCTTTGTTGTGTTGT”

Non ci credete…..

Homo sapiens chromosome 8, GRCh38.p13 Primary Assembly

NCBI Reference Sequence: NC_000008.11

FASTA Graphics

Go to:

LOCUS       NC_000008                 18 bp    DNA     linear   CON 17-AUG-2020
DEFINITION  Homo sapiens chromosome 8, GRCh38.p13 Primary Assembly.
ACCESSION   NC_000008 REGION: 63648346..63648363
VERSION     NC_000008.11
DBLINK      BioProject: PRJNA168
Assembly: GCF_000001405.39
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 18)
  AUTHORS   Nusbaum,C., Mikkelsen,T.S., Zody,M.C., Asakawa,S., Taudien,S.,
            Garber,M., Kodira,C.D., Schueler,M.G., Shimizu,A., Whittaker,C.A.,
            Chang,J.L., Cuomo,C.A., Dewar,K., FitzGerald,M.G., Yang,X.,
            Allen,N.R., Anderson,S., Asakawa,T., Blechschmidt,K., Bloom,T.,
            Borowsky,M.L., Butler,J., Cook,A., Corum,B., DeArellano,K.,
            DeCaprio,D., Dooley,K.T., Dorris,L. III, Engels,R., Glockner,G.,
            Hafez,N., Hagopian,D.S., Hall,J.L., Ishikawa,S.K., Jaffe,D.B.,
            Kamat,A., Kudoh,J., Lehmann,R., Lokitsang,T., Macdonald,P.,
            Major,J.E., Matthews,C.D., Mauceli,E., Menzel,U., Mihalev,A.H.,
            Minoshima,S., Murayama,Y., Naylor,J.W., Nicol,R., Nguyen,C.,
            O'Leary,S.B., O'Neill,K., Parker,S.C., Polley,A., Raymond,C.K.,
            Reichwald,K., Rodriguez,J., Sasaki,T., Schilhabel,M., Siddiqui,R.,
            Smith,C.L., Sneddon,T.P., Talamas,J.A., Tenzin,P., Topham,K.,
            Venkataraman,V., Wen,G., Yamazaki,S., Young,S.K., Zeng,Q.,
            Zimmer,A.R., Rosenthal,A., Birren,B.W., Platzer,M., Shimizu,N. and
            Lander,E.S.
  TITLE     DNA sequence and analysis of human chromosome 8
  JOURNAL   Nature 439 (7074), 331-335 (2006)
   PUBMED   16421571
  REFERENCE   2  (bases 1 to 18)
  CONSRTM   International Human Genome Sequencing Consortium
  TITLE     Finishing the euchromatic sequence of the human genome
  JOURNAL   Nature 431 (7011), 931-945 (2004)
  PUBMED   15496913

REFERENCE   3  (bases 1 to 18)
  AUTHORS   Lander,E.S., Linton,L.M., Birren,B., Nusbaum,C., Zody,M.C.,
            Baldwin,J., Devon,K., Dewar,K., Doyle,M., FitzHugh,W., Funke,R.,
            Gage,D., Harris,K., Heaford,A., Howland,J., Kann,L., Lehoczky,J.,
            LeVine,R., McEwan,P., McKernan,K., Meldrim,J., Mesirov,J.P.,
            Miranda,C., Morris,W., Naylor,J., Raymond,C., Rosetti,M.,
            Santos,R., Sheridan,A., Sougnez,C., Stange-Thomann,N.,
            Stojanovic,N., Subramanian,A., Wyman,D., Rogers,J., Sulston,J.,
            Ainscough,R., Beck,S., Bentley,D., Burton,J., Clee,C., Carter,N.,
            Coulson,A., Deadman,R., Deloukas,P., Dunham,A., Dunham,I.,
            Durbin,R., French,L., Grafham,D., Gregory,S., Hubbard,T.,
            Humphray,S., Hunt,A., Jones,M., Lloyd,C., McMurray,A., Matthews,L.,
            Mercer,S., Milne,S., Mullikin,J.C., Mungall,A., Plumb,R., Ross,M.,
            Shownkeen,R., Sims,S., Waterston,R.H., Wilson,R.K., Hillier,L.W.,
            McPherson,J.D., Marra,M.A., Mardis,E.R., Fulton,L.A.,
            Chinwalla,A.T., Pepin,K.H., Gish,W.R., Chissoe,S.L., Wendl,M.C.,
            Delehaunty,K.D., Miner,T.L., Delehaunty,A., Kramer,J.B., Cook,L.L.,
            Fulton,R.S., Johnson,D.L., Minx,P.J., Clifton,S.W., Hawkins,T.,
            Branscomb,E., Predki,P., Richardson,P., Wenning,S., Slezak,T.,
            Doggett,N., Cheng,J.F., Olsen,A., Lucas,S., Elkin,C.,
            Uberbacher,E., Frazier,M., Gibbs,R.A., Muzny,D.M., Scherer,S.E.,
            Bouck,J.B., Sodergren,E.J., Worley,K.C., Rives,C.M., Gorrell,J.H.,
            Metzker,M.L., Naylor,S.L., Kucherlapati,R.S., Nelson,D.L.,
            Weinstock,G.M., Sakaki,Y., Fujiyama,A., Hattori,M., Yada,T.,
            Toyoda,A., Itoh,T., Kawagoe,C., Watanabe,H., Totoki,Y., Taylor,T.,
            Weissenbach,J., Heilig,R., Saurin,W., Artiguenave,F., Brottier,P.,
            Bruls,T., Pelletier,E., Robert,C., Wincker,P., Smith,D.R.,
            Doucette-Stamm,L., Rubenfield,M., Weinstock,K., Lee,H.M.,
            Dubois,J., Rosenthal,A., Platzer,M., Nyakatura,G., Taudien,S.,
            Rump,A., Yang,H., Yu,J., Wang,J., Huang,G., Gu,J., Hood,L.,
            Rowen,L., Madan,A., Qin,S., Davis,R.W., Federspiel,N.A.,
            Abola,A.P., Proctor,M.J., Myers,R.M., Schmutz,J., Dickson,M.,
           Grimwood,J., Cox,D.R., Olson,M.V., Kaul,R., Raymond,C., Shimizu,N.,
            Kawasaki,K., Minoshima,S., Evans,G.A., Athanasiou,M., Schultz,R.,
            Roe,B.A., Chen,F., Pan,H., Ramser,J., Lehrach,H., Reinhardt,R.,
            McCombie,W.R., de la Bastide,M., Dedhia,N., Blocker,H.,
            Hornischer,K., Nordsiek,G., Agarwala,R., Aravind,L., Bailey,J.A.,
            Bateman,A., Batzoglou,S., Birney,E., Bork,P., Brown,D.G.,
            Burge,C.B., Cerutti,L., Chen,H.C., Church,D., Clamp,M.,
            Copley,R.R., Doerks,T., Eddy,S.R., Eichler,E.E., Furey,T.S.,
            Galagan,J., Gilbert,J.G., Harmon,C., Hayashizaki,Y., Haussler,D.,
            Hermjakob,H., Hokamp,K., Jang,W., Johnson,L.S., Jones,T.A.,
            Kasif,S., Kaspryzk,A., Kennedy,S., Kent,W.J., Kitts,P.,
            Koonin,E.V., Korf,I., Kulp,D., Lancet,D., Lowe,T.M., McLysaght,A.,
            Mikkelsen,T., Moran,J.V., Mulder,N., Pollara,V.J., Ponting,C.P.,
            Schuler,G., Schultz,J., Slater,G., Smit,A.F., Stupka,E.,
            Szustakowski,J., Thierry-Mieg,D., Thierry-Mieg,J., Wagner,L.,
            Wallis,J., Wheeler,R., Williams,A., Wolf,Y.I., Wolfe,K.H.,
            Yang,S.P., Yeh,R.F., Collins,F., Guyer,M.S., Peterson,J.,
            Felsenfeld,A., Wetterstrand,K.A., Patrinos,A., Morgan,M.J., de
            Jong,P., Catanese,J.J., Osoegawa,K., Shizuya,H., Choi,S. and
            Chen,Y.J.
  CONSRTM   International Human Genome Sequencing Consortium
  TITLE     Initial sequencing and analysis of the human genome
  JOURNAL   Nature 409 (6822), 860-921 (2001)
   PUBMED   11237011
  REMARK    Erratum:[Nature 2001 Aug 2;412(6846):565]
COMMENT     REFSEQ INFORMATION: The reference sequence is identical to
            CM000670.2.
            On Feb 3, 2014 this sequence version replaced NC_000008.10.
            Assembly Name: GRCh38.p13 Primary Assembly
            The DNA sequence is composed of genomic sequence, primarily
            finished clones that were sequenced as part of the Human Genome
            Project. PCR products and WGS shotgun sequence have been added
            where necessary to fill gaps or correct errors. All such additions
            are manually curated by GRC staff. For more information see:
            https://genomereference.org.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                                      Release 109.20200815            Annotation Version          :: 109.20200815
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..18
                     /organism="Homo sapiens"
                     /mol_type="genomic DNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
ORIGIN    
  
        1 ctccctttgt tgtgttgt
//

Link : https://www.ncbi.nlm.nih.gov/nucleotide/NC_000008.11?report=genbank&log$=nuclalign&from=63648346&to=63648363

Per quanto ne so, ciò significa che i kit di test dell’OMS dovrebbero trovare un risultato positivo in tutti gli esseri umani.

Qualcuno può spiegarlo diversamente?

Non possiamo sottovalutare tale scoperta ed il suo significato …..

Anticipando le possibili osservazioni….. di mega professori e ricercatori ….. che potrebbero affermare …

… il virus è un virus a RNA e il cromosoma 8 è il DNA. Non verrà replicato dalla RT-PCR, perché questo processo inizia con la trascrittasi inversa (RT!) E quindi non copia il DNA.

Replica …. La domanda rimanente è se questo frammento possa esistere come RNA nelle cellule umane, il che è ancora possibile…Inoltre, è anche necessario avere la sonda in prossimità del primer. Se la PCR non colpisce la sonda, il test rimarrà negativo. La sonda si trova nel cromosoma 8?

Senza entrare troppo nei tecnicismi , Come minimo, dovrebbe avere un impatto notevole sui risultati dei test.

Riprendiamo le nostre considerazioni sulla base di quanto a conoscenza del mondo scientifico.

Quindi, come si fa a isolare un virus specifico da questa enorme miscela di miliardi di particelle indistinguibili, che include esosomi benefici?

Ebbene, non si fa, è impossibile, e quindi si “ricrea” il virus tramite la RT- PCR: prendi due primers, due sequenze genetiche già esistenti disponibili in banche genetiche, e li metti in contatto con il brodo del surnatante, finché non si attaccano (annealing) ad un qualche frammento di RNA nel brodo, creando così una molecola di DNA artificiale, che è poi moltiplicata con un certo numero di corse di PCR: ogni corsa raddoppia la quantità di DNA, quindi in teoria più corse maggiore è la quantità di DNA prodotta; ma maggiore è il numero di corse, minore è l’affidabilità della PCR, ovvero la sua capacità di “produrre” effettivamente qualcosa di significativo dal supernatante, qualcosa che abbia minimamente a che fare col virus che si cerca: oltre le 30 corse il risultato è essenzialmente privo di significato (come affermato anche da uno dei massimi esperti mondiali di PCR, il prof. Stephen Bustin).

Tutti gli studi, così come gli attuali test con tampone, utilizzano sempre tra le 35 e le 40 corse.

La prima domanda senza risposta è: i primer sono costituiti da 18-24 basi (nucleotidi) ciascuno; il virus SARS-Cov2 è presumibilmente composto da 30.000 basi; così il primer rappresenta solo lo 0,07% del genoma del virus.

Come è possibile selezionare il virus specifico che stai cercando sulla base di un primer così minuto, e inoltre in un mare di miliardi di particelle simili a virus?

 Sarebbe come cercare un elefante utilizzando piccolissimi peli di colore grigio della coda: cercando con tali peli di colore grigio si possono trovare gatti grigi, cani grigi, esseri umani ingrigiti e così via.

Ma c’è di più.

Poiché il virus che stai cercando è nuovo, chiaramente non ci sono primer genetici pronti che si abbinino con la frazione specifica del nuovo virus; quindi si prendono i primers che si ritiene possano assomigliare alla struttura del virus ipotizzata, ma è una mera supposizione, e quando applichi i primers al brodo del surnatante, questi possono attaccarsi a una qualsiasi dei miliardi di molecole presenti, e non si ha nessuna certezza che quello che hai così generato è il virus che stai cercando.

Si tratta, infatti, di una nuova creazione artificiale realizzata dai ricercatori, che viene poi chiama “virus SARS-Cov2”, ma non c’è alcun collegamento con il presunto virus responsabile della malattia.

La metodologia RT-PCR standard è afflitta da problemi fondamentali, e questa è la ragione per cui ora stanno cercando di sviluppare una nuova tecnologia, chiamata NGS (new generation sequencing), che è però anch’essa piena di limitazioni, limitazioni di cui sono consapevoli i ricercatori più onesti:

“Le metodologie basate sulla PCR più comunemente utilizzate richiedono la conoscenza delle sequenze genomiche del microrganismo; tuttavia, questa conoscenza non è sempre a disposizione. Un caso tipico è rappresentato dai focolai di patogeni emergenti …

Perché l’amplificazione casuale / imparziale amplifica gli acidi nucleici dell’ospite insieme a quelli microbici, cercare gli acidi nucleici microbici è come cercare un ago in un pagliaio. “

E questo, che corrisponde a quanto detto finora, riguarda sia RT-PCR che NSG.

Questo anche perché molti studi hanno dimostrato che fino al 95% delle particelle simili a virus presenti nel corpo dei pazienti appartengono al genoma del paziente stesso:

“L’identificazione degli acidi nucleici dei patogeni nei campioni clinici è complicata dalla presenza del solito preponderante background ospite … Nello studio di Brown e colleghi, è stato possibile non assegnare al genoma umano solo lo 0,4% delle letture totali.” [ Calistri A. Palù G., Unbiased Next-Generation Sequencing and New Pathogen Discovery:Undeniable Advantages and Still-Existing Drawbacks, Clinical Infectious Diseases, 2015; 60(6):889–91, p.889.]

Il che conferma la tesi che il liquido faringeo o bronco-alveolare del paziente è come un mare di miliardi di particelle simil-virali, e la maggior parte delle quali, come vescicole extracellulari e esosomi, appartengono al genoma del paziente.

E questo solleva la domanda successiva:

Se non hai idea di cosa sia il virus, di come sia fatto, come puoi dire che è responsabile di qualcosa?

Tuttavia, i ricercatori cinesi hanno anche cercato di dimostrare la patogenicità del virus.

In uno specifico studio cinese [Bao L. Et al. The Pathogenicity of SARS-CoV-2 in hACE2 Transgenic Mice, Nature (2020) 10.1038/s41586-020-2312-y.] , hanno preso il supernatante del liquido faringeo (spacciandolo per virus isolato), e l’hanno iniettato nei topi, confrontandolo con un placebo.

Ora, anche se non è stato isolato, se ci fosse davvero un virus responsabile della malattia, esso sarebbe comunque presente in quantità rilevanti nel surnatante del liquido patologico del paziente.

Perciò, una volta iniettato nelle cavie dovrebbe ancora produrre effetti devastanti sugli animali.

Ma l’effetto peggiore che ha prodotto è stato un pò di “pelo irto” e una minima riduzione di peso dell’8, ma anche questi minimi effetti sono stati ottenuti solo sui topi geneticamente modificati, mentre non c’è stato assolutamente nessun effetto sul topi naturali, non geneticamente modificati o “wild” (WT).

Come riportato nello studio :

“Topi maschi e femmine liberi da patogeni specifici ( n = 15) o hACE2 ( n  = 19) di età compresa tra 6 e 11 mesi sono stati inoculati per via intranasale con SARS-CoV-2 ceppo HB-01 alla dose di 10 5 50% di dose infettiva di coltura tissutale (TCID 50 ) per 50 μl di volume di inoculo per topo, dopo che i topi sono stati anestetizzati per via intraperitoneale utilizzando il 2,5% di avertina; topi hACE2 trattati con simulazione ( n = 15) sono stati usati come controllo.

 Le manifestazioni cliniche sono state registrate da 13 topi (3 topi wild-type infettati con HB-01; 3 topi hACE2 trattati con simulazione; e 7 topi hACE2 infettati con HB-01). 

Abbiamo osservato una leggera peluria e una perdita di peso solo nei topi hACE2 infettati con HB-01 – e non nei topi wild-type infettati da HB-01 o nei topi hACE2 trattati con simulazione – durante i 14 giorni di osservazione; altri sintomi clinici, come una schiena inarcata e una ridotta risposta agli stimoli esterni, non sono stati trovati in nessuno dei topi. 

In particolare, la perdita di peso dei topi hACE2 infettati con HB-01 era fino all’8% 5 giorni dopo l’infezione (dpi) (Fig. 1a ).

Fig.1: Perdita di peso, replicazione del virus e produzione di IgG specifiche nei topi hACE2 dopo infezione da SARS-CoV-2.







a , La perdita di peso è stata registrata per 14 giorni. Topi hACE2 ( n  = 7) e topi wild-type (WT) ( n  = 3) sono stati sfidati sperimentalmente per via intranasale con SARS-CoV-2 HB-01 e topi hACE2 (ACE2 + mock) trattati con mock ( n  = 3) sono stati usati come controllo. Secondo il test U di Mann-Whitney a due code , il peso dei topi hACE2 infettati con HB-01 (ACE2 + HB-01) ha mostrato un calo significativo rispetto a quello dei topi wild-type infettati con HB-01 (WT + HB-01) -01) o topi hACE2 trattati con mock (*** P  = 0.0005). 
b, Per misurare l’RNA virale, 12 topi sono stati infettati in ciascun gruppo. Tre topi per gruppo sono stati uccisi e i loro organi principali (compreso il testicolo nei topi maschi) sono stati raccolti per l’analisi della carica virale e del titolo del virus a 1, 3, 5 e 7 dpi. La distribuzione di SARS-CoV-2 negli organi primari dei topi hACE2 infettati con HB-01 è stata rilevata utilizzando RT-qPCR. 
c , i titoli dei virus nei polmoni sono stati determinati sulle cellule Vero E6. Secondo un test t di Welch non accoppiato a due code , i titoli virali nei polmoni di topi hACE2 infettati con HB-01 ( n  = 3) hanno mostrato un aumento significativo rispetto a quelli dei topi wild-type infettati con HB-01 ( n  = 3) o topi hACE2 trattati con simulazione ( n  = 3) a 1 (** P  = 0,0053), 3 (** P = 0,0022) e 5 (** P  = 0,0081) dpi.
 d , Virus isolato dai polmoni di topi hACE2 infettati con HB-01 a 3 dpi è stato osservato mediante microscopia elettronica. Barra della scala, 200 nm. I dati sono rappresentativi di tre esperimenti indipendenti. 
e , L’IgG specifica contro SARS-CoV-2 è stata rilevata dai sieri di topi (topi wild-type ( n  = 3) o hACE2 (  n  = 7) infettati con HB-01 ) al giorno 0 e 21 dpi mediante enzima- saggio di immunoassorbimento collegato (ELISA). OD 450 , densità ottica a 450 nm. Test t di Student spaiato a due code ; non significativo (NS), P  = 0,2193; Test t di Welch spaiato a due code , *** P  = 3,11 × 10−6 . I dati in a – c , e sono media ± sd

Vorrei …. Evidenziare che tutto lo studio è basato sui TOPI….. non esseri umani…. Per di più modificati …. appropriatamente per l’esperimento … come riportato nello studio :

“Esperimenti sui topi

Per gli esperimenti sui topi, topi maschi e femmine di età compresa tra 6 e 11 mesi, privi di patogeni specifici, sono stati ottenuti dall’Institute of Laboratory Animal Science, Peking Union Medical College.

Topi transgenici sono stati generati mediante microiniezione del promotore di Ace2 di topo che guida la sequenza codificante ACE2 umana nei pronuclei di ovuli fecondati da topi ICR, e quindi ACE2 umano integrato è stato identificato mediante PCR come descritto in precedenza 10 ; l’ACE2 umano espresso principalmente nei polmoni, nel cuore, nei reni e nell’intestino dei topi transgenici.

Dopo essere stati anestetizzati per via intraperitoneale con il 2,5% di avertina con 0,02 ml / g di peso corporeo, i topi hACE2 o wild-type (ICR) sono stati inoculati per via intranasale con il virus stock SARS-CoV-2 alla dose di 10 5 TCID50 e topi hACE2 inoculati per via intranasale con un volume uguale di PBS sono stati usati come controllo dell’infezione fittizia.

 I topi infetti sono stati continuamente osservati per registrare il peso corporeo, i sintomi clinici, le risposte a stimoli esterni e la morte. I topi sono stati sezionati a 1, 3, 5 e 7 dpi per raccogliere diversi tessuti per lo screening della replicazione del virus e dei cambiamenti istopatologici.

Preparazione di laboratorio dell’anticorpo della proteina SARS-CoV-2 S1

I topi sono stati immunizzati con la proteina SARS-CoV-2 S1 purificata (biologica Sino) e gli splenociti di topi iperimmunizzati sono stati fusi con cellule di mieloma. I cloni positivi sono stati selezionati mediante ELISA utilizzando la proteina SARS-CoV-2 S1 (Dati estesi Fig. 5). Il supernatante cellulare del clone 7D2, che si lega alla proteina SARS-CoV-2 S1, è stato raccolto per l’analisi di immunofluorescenza.“

Dati estesi Fig. 5: Identificazione dell’anticorpo 7D2 contro la proteina SARS-CoV-2 S1.




La piastra rivestita con 0,2 μg di proteina SARS-CoV-2 S1 è stata incubata con l’anticorpo 7D2 come anticorpo primario (1: 200) e rilevata utilizzando l’anticorpo secondario anti-topo di capra coniugato con HRP. Il titolo dell’anticorpo è stato determinato utilizzando ELISA. I dati sono medi ± sd Le differenze significative sono indicate con asterischi ( n  = 3, t -test di Student  spaiato a due code , ** P = 0,0011).

Questo  significa che il virus è incapace di fare il benché minimo danno sui topi normali, e dunque….”presumibilmente” su individui umani normali.

I topi sono stati geneticamente modificati per iper-produrre lo speciale enzima ACE2, la cui iperproduzione potrebbe spiegare alcuni dei sintomi leggeri riscontrati nel topi geneticamente modificati. [ Solo per fare un esempio, l’enzima ACE2 scinde, o disaggrega, l’ormone grelina, responsabile dello stimolo della fame, quindi l’iper-produzione di ACE2 può diminuire la fame e contribuire alla perdita di peso. Unger T, Ulrike M, Steckelings UM, dos Santos RA (eds.). The protective arm of the Renin Angiotensin System (RAS): functional aspects and therapeutic implications, Academic Press. pp. 185–189.]

Quel che è certo è che nessun effetto di sorta è stato prodotto dal cosiddetto virus su topi.

E questo è lo studio più importante che dimostra la patogenicità del virus Covid-19, l’articolo per eccellenza pubblicato sulla più importante rivista scientifica, Nature!

Poiché questo virus non è mai stato realmente isolato, e quindi non esiste un gold standard per supportare ulteriori studi o test, nessuno standard che li guidi, chiunque è libero di costruirsi il proprio virus SARS-Cov2 privato!

Questo è il motivo per cui ora ci sono, in GISAID genome bank, l’organizzazione che raccoglie e archivia tutte le sequenze genomiche, oltre 70.000 sequenze geniche del virus SARS-Cov2, ciascuna delle quali dichiara di essere quella reale.

Per adattarsi a questa follia, ora ci dicono che il virus muta, ed è per questo che ci sono tante sequenze diverse. Ma è credibile che 70.000 diverse strutture geniche tutte corrispondano allo stesso virus?

Sarebbe come se avessi un John, di cui sono 70.000 immagini diverse, in ognuna delle quali sembra un uomo, poi una donna, poi un cane, poi un serpente, e così via, eppure vorresti convincermi che sono tutti e sempre John!

Questo, tra l’altro, solleva un’ulteriore questione molto importante: se il presunto virus muta tanto da aver prodotto oltre 70.000 sequenze genetiche diverse, quale di questi sarà selezionato per il vaccino?

E come può il vaccino coprire qualcosa se gli altri 69.999 sequenza non sono coperti e il virus, in ogni caso, continua a mutare costantemente?

Ed eccoci al problema del tampone, il vero motore di questo pseudo- pandemia.

Come abbiamo spiegato all’inizio, il test del tampone utilizza la stessa tecnica che abbiamo visto sopra per lo pseudo-isolamento, a partire dal liquido presuntivamente infetto del paziente.

Questo liquido viene centrifugato, quindi inserito nel test prestabilito che dovrebbe avere lo standard virale, cioè il virus isolato, incorporato.

Ma se il virus non è mai stato isolato, qual è lo standard utilizzato?

Vari studi hanno trovato molte mutazioni e variazioni tra i diversi ceppi geografici: un articolo, che include anche Robert Gallo tra gli autori, ha riscontrato decine di mutazioni crescenti nel tempo in parallelo con la presunta diffusione del virus dall’Asia all’Europa agli USA [ Pachetti M. et al., Emerging SARS-CoV-2 mutation hot spots include a!novel RNA-dependent RNA polymerase variant, J Transl Med (2020) 18:179 https://doi.org/10.1186/s12967-020-02344-6 ]; mentre un altro autore ha analizzato 85 diverse sequenze genomiche SARS-Cov2 disponibili presso GISAID, e ha trovato ben 53 divers ceppi SARS-Cov2 provenienti da varie aree della Cina, dell’Asia, dell’Europa e degli Stati Uniti. [ Phan Tung, Genetic diversity and evolution of SARS-CoV-2, Infection, Genetics and Evolution,  81 (2020), 104260 ]

Quindi, quale di questi ceppi virali sta cercando il tampone?

Se il virus muta costantemente (ammesso e non concesso che il virus ci sia), allora il test è inutile, perché va a cercare un virus sempre precedente rispetto a quello attualmente in circolazione.

Basterebbe questo da solo per capire che il tampone Covid-19 – il test è completamente, al 100%, fallace!

Questo è davvero ciò che accade nella realtà.

Il “Drosten PCR Test” e il test dell’“Institute Pasteur”, i due test considerati i più affidabili (sebbene nessuno dei due lo sia stato convalidato esternamente), entrambi utilizzano un test del gene E, anche se il test di Drosten lo utilizza come test preliminare, mentre l’Institut Pasteur lo utilizza come test definitivo.

Secondo gli autori del Drosten test [ Corman VM et al., Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR, Euro Surveill. 2020 Jan 23; 25(3): 2000045. ] , il test E-gene è in grado di rilevare tutti i virus asiatici, essendo così al contempo molto aspecifico (tutti i ceppi viruali) e limitato ad un’area geografica (Asia).

Ancora, il test Institut Pasteur, uno dei più adottati in Europa, utilizza il test E-Gene come a test finale, anche se è ormai noto che il virus (o virus) SARS-Cov2 che si ritiene circolino in Europa sarebbero diversi da quelli asiatici.

E poi ad aprile, l’OMS ha cambiato l’algoritmo “… raccomandando che da ora in poi un test può essere considerato positivo anche se solo il dosaggio del gene E (che probabilmente rileverà tutti i  virus asiatici!) dà un risultato positivo“.[Engelbrecht T, Demeter K., COVID19 PCR Tests are Scientifically Meaningless, Jun 27 2020, p.21.                https://off-guardian.org/2020/06/27/covid19-pcr-tests-are-scAR3G6Fuq8C-8XW7szL43scbKOYFx78irq52A6ZQCRdZmPMWiHTqD_2jv4Zo]

Chiaramente tutto questo è buono solo per alimentare falsi positivi e il panico sociale associato con l’esplosione della “malattia” dell’asintomaticità Covid!

Che il test del tampone Covid-19 sia destinato a produrre molti falsi positivi lo era già trovato all’inizio in Cina, quando un articolo [Zonghua L et al, Potential false-positive rate among the ‘asymptomatic infected individuals’ in close contacts of COVID-19 patients, 2020 Mar 5;41(4):485-488.doi: 10.3760/ cma.j.cn112338-20200221-00144]  è stato pubblicato il 5 marzo 2020 (quindi riferendosi ai test effettuati a febbraio) e riportando un numero dell’80,3% di falsi positivi.

 È interessante notare che, dopo l’esplosione della “pandemia”, il giornale cinese ha ritirato l’articolo!

Ma la sanzione ufficiale dell’inefficacia e della totale inaffidabilità del test Covid-19 è arrivato da un ambito inaspettato, quello dell’Unione Europea.

Nel Working Document della Commissione Europea del 16 aprile scorso, cioè dopo il picco della pseudo-pandemia , la Commissione Europea afferma:

“I test COVID-19 tempestivi e accurati sono una parte essenziale della gestione della crisi COVID-19 … dopo essere stati immessi sul mercato le performance dei dispositivi possono essere convalidate, vale a dire confermate da test aggiuntivi che confermino le specifiche del produttore, ad es. nei laboratori di riferimento, nelle istituzioni accademiche o nelle agenzie nazionali di regolamentazione.

Tale convalida non è legalmente obbligatoria ma altamente raccomandata per il processo decisionale di sanità pubblica ”.[ European Commission, Working Document of Commission Services, Current performance of COVID-19 test methods and devices and proposed performance criteria, April 16 2020.  ]

Ci si aspetterebbe che ci fosse uno standard, una metodologia di test fondamentale che sia validata e pre-autorizzata.

Qui non si tratta di un prodotto voluttuario lasciato alla gestione del libero mercato, ma di uno strumento che è stato essenziale per giustificare il potere dei governi di imporre la peggiore chiusura dittatoriale dei diritti civili ed economici che si possa ricordare a memoria d’uomo!

Invece, questa è la situazione descritta dalla stessa Commissione EU:

“In totale, 78 dispositivi basati su RT-PCR… 101 per la rilevazione di anticorpi e 13 per la rilevazione degli antigeni sono stati valutati. “

Di questi 78 dispositivi, alcuni importati dalla Cina, nessuno è mai stato controllato o ispezionato, figuriamoci convalidato, in anticipo.

Solo 3, “… quelli dell’Institut Pasteur, l’Hong Kong Faculty of Medicine e la Charité sono state convalidate internamente ”, cioè certificate come valido dal produttore stesso, il che equivale a dire che anche quelli non sono mai stati convalidati o autorizzati da un qualsiasi organismo indipendente o governativo. Inoltre:

“Le informazioni più cruciali in relazione ai metodi di RT-PCR per la rilevazione di SARS-CoV-2 sono le sequenze degli oligonucleotidi (primers e probes) utilizzati per l’amplificazione del cDNA…ad eccezione di pochi casi, non abbiamo potuto trovare nessuna informazione sulle effettive sequenze dei primers e dei probes utilizzate nei dispositivi.”

In altre parole, i dispositivi in circolazione potrebbero contenere qualsiasi tipo di cosa, per quel che ne sanno le autorità.

E lo stesso livello di inaffidabilità si applica anche ai test sierologici o anticorpali non solo perché, come abbiamo visto sopra, ne circolano oltre 100 tipi diversi senza nessuna preventiva valutazione o autorizzazione, ma perché alla base del test sierologico sta lo stesso fondamentale limite che affligge il tampone, ovvero l’assenza di uno standard affidabile a causa del mancato isolamento del virus.

Quando si parla di sierologico si parla di anticorpi, e tutti probabilmente pensano che esistano anticorpi specifici per ciascun virus.

Niente di più lontano dalla realtà: gli anticorpi che si ritrovano con il sierologico sono solo due, e solo sempre quelli, le IgG e le IgM, quest’ultime risposte immunitarie precoci, mentre le igG si generano più tardi.

Ora, se sono sempre e solo due, come si fa a capire se si riferiscano al SARS-Cov2 e non a un raffreddore, o uno stress emotivo, a una contusione, e così via?

In teoria, si estraggono tali anticorpi dal siero, e li si sottopone alla stessa metodologia PCR usata per il tampone, per vedere se si attivano a contatto del SARS-Cov2.

Ma poiché, come abbiamo visto, il SARS-Cov2 non è mai stato isolato, ed è solo una costruzione artificiale di laboratorio, il risultato del sierologico è un mero terno al lotto, che probabilmente si attiva o non si attiva in modo casuale, senza nessun vero rapporto con il presunto virus che è presunta causa del Covid-19.

Alla data odierna i presunti dati genomici del hCOV-19 riportati dal GISAID – Istituto Genomico Internazionale – riportano 100.000 sequenze genomiche virali di hCoV-19 provenienti dai laboratori di tutto il mondo,  che stanno generando dati sulla sequenza del genoma virale con una velocità senza precedenti.

Insomma, abbiamo affidato la fine della nostra libertà a tali non controllati, mai convalidati e mai autorizzati test, siano essi tamponi o sierologici!

Ringraziando tutti per la pazienza…. nella lettura di questo testo molto esteso e complicato, ci auguriamo che sia uno spunto di “RIFLESSIONE E VERIFICA” di qunato ci viene propinato dai Media e dalla Politica….. per non parlare del mondo scientifico…. non propriamente neutrale….. agli interessi della popolazione mondiale.

Siamo aperti ad osservazioni e controvalutazioni… ma sempre con dati scientifici e prove…..

LEAVE A REPLY

Please enter your comment!
Please enter your name here

Questo sito usa Akismet per ridurre lo spam. Scopri come i tuoi dati vengono elaborati.